2024-05-06 05:21:50, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_023490768 2604 bp mRNA linear INV 16-OCT-2023 DEFINITION PREDICTED: Eurytemora carolleeae protein argonaute-4 (LOC111715445), transcript variant X2, mRNA. ACCESSION XM_023490768 VERSION XM_023490768.1 DBLINK BioProject: PRJNA423276 KEYWORDS RefSeq. SOURCE Eurytemora carolleeae ORGANISM Eurytemora carolleeae Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Crustacea; Multicrustacea; Hexanauplia; Copepoda; Calanoida; Temoridae; Eurytemora. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_019397675.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_000591075.1-RS_2023_10 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 10/05/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2604 /organism="Eurytemora carolleeae" /mol_type="mRNA" /db_xref="taxon:1294199" /chromosome="Unknown" gene 1..2604 /gene="LOC111715445" /note="protein argonaute-4; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 12 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 49 samples with support for all annotated introns" /db_xref="GeneID:111715445" CDS 43..2589 /gene="LOC111715445" /codon_start=1 /product="protein argonaute-1 isoform X2" /protein_id="XP_023346536.1" /db_xref="GeneID:111715445" /translation="
MKTEINITELNIFTESIITDYTPPDSRECSNSPPSRPASPPTKRKFHAQRRPALGQEGKPISLRANHLEVSVKPGYIYQYNVNITPGGCPRRVNREIVKTMVDAYTAIWRTSMGPILPVYDGRESLYTIEPIPSVEDKENLELQVTLAAHDGRERSFMVMVSYEQKISLYDLLSSIEGRLREVPEDAAFALDVVMRHLPSMLYTPVGRSFFSPPTNYFHPLGGGREVWFGFHQSVRPSHWKMTLNIDVSATAFYKGQSVVEFASELLDLRNLESGVQLNDTQRSRLAKELKGLKVEITHSQIARKYRVCNLTRRSAQMQCFPLQLENGQTVECTVSKFFMDKYRMKLRYPGLPCLQVGQEHKHTYLPMEVCRIVAGQRCLKKLTDLQTSTMIKATARSAPDREREIRNLITKADFNNDPYVKKFGLDVSQRMMETQGRVLNPPKLEYGSRSARTFTVPSQGVWDMRGKQFYEGMTIKHWAIACFTPQQSVKPQDLKLFVDRLSQISSDLGMRIIREPCFCKYIHDATSVMPMFNFLKKEFPELQLIVVVLPGKTPVYAEVKRMGDSVLGIATQCIKSKNVTRTTAQMLSNLCLKINAKLGGINTILVPENRIRIFSEPLMFLGATVTHPPAGDTKKPSIAALVASVDAHPSLYSAVVRIQMARMDVINALYEMVKESLVNFYVKTGFKPHRIVMYRDGVSEGQFASVLQNELLAIRKACVSLETDYRPGITFIVVQKRHHTRLFCANPRDQSGRSGNVPAGTTVDSNITHPTENDFYLCSHQGIQGTSRPSYYRCLWDDNQLTADELQTMTYSLCHTYARCTRSVSIPAPAYYAHLVAIRARYHIIGN"
misc_feature 394..627 /gene="LOC111715445" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 655..807 /gene="LOC111715445" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 811..1164 /gene="LOC111715445" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(958..960,1003..1005,1045..1047,1057..1059, 1111..1113,1132..1134,1138..1140) /gene="LOC111715445" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1297..2577 /gene="LOC111715445" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1711..1713,1723..1725,1759..1770,1777..1779, 1801..1803,1810..1812,1822..1824,1834..1836) /gene="LOC111715445" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1915..1917,1921..1923,2131..2133,2545..2547) /gene="LOC111715445" /note="active site" /db_xref="CDD:240015" ORIGIN
atatgagataatttcagaatagaaaatatttacttcaacacaatgaaaactgagataaacataacggagctgaatattttcacagaatctattataacagattatactcccccggactcaagggagtgttctaactctcctccctccagaccagcctccccgcccactaaacggaagtttcatgcccaacgcaggcctgcgctagggcaggagggtaaacccatttctctcagagcaaatcatttagaggtatctgttaaacccgggtacatataccagtacaacgtcaacattacacctggtggatgtccaagacgtgtgaatcgtgaaattgtaaaaactatggtggatgcttatacagccatatggagaacttcaatgggtcctattctccctgtatatgatggtagagagagcctgtatactattgaacctataccaagtgtagaggataaggagaatcttgaactccaggtaaccctagcagcgcatgatgggagggagagatcttttatggtcatggtctcttatgagcaaaagatctccttgtatgatctgctgtctagtattgaaggtcgtcttcgagaagtgccggaagatgctgcttttgctttagatgttgttatgcgacacctacctagtatgctgtatactcccgtagggcgttcgttcttttccccgcctaccaactatttccacccccttggagggggtagagaggtttggtttggttttcaccaatctgttcggccttcacactggaagatgacgcttaacatagatgtctctgcaacagctttctacaaaggacaatcagttgtggagtttgcttcagagttgctagatctcagaaatcttgaatctggtgttcaactcaacgacacccagcgctctaggcttgccaaagagttgaaaggactgaaggtggagatcacccattctcagattgcgcgcaaataccgcgtttgcaatcttacgcgacgaagtgcgcagatgcaatgctttccgcttcagctggagaacggtcaaactgtggagtgtactgtgtcaaagttcttcatggacaaatacaggatgaaactaagatatccaggtctaccctgtctccaggttggacaggagcacaagcatacctatctacccatggaggtatgtcgtatagtagctgggcagagatgtttgaagaagttgaccgacctacagacctcaactatgatcaaggcaaccgctagatctgctccagatagagagagagaaattaggaatctaatcaccaaagctgatttcaacaatgatccctatgtgaagaagtttggtctggatgtatcccaaagaatgatggaaacccagggtagggttctgaaccctcctaaactggaatatggttccaggagtgccagaacattcacagtgcccagtcaaggagtttgggacatgcgaggaaaacagttctatgaagggatgacaattaaacattgggcaattgcctgctttacacctcagcagtcagtcaaaccccaggatctgaagctgtttgttgaccgtctaagccagatctccagcgacctgggaatgaggataatcagagaaccctgcttctgtaaatatattcatgatgctaccagtgttatgcccatgttcaacttccttaagaaagagttccctgagttgcagctgattgttgttgtactccctgggaaaactcccgtctatgctgaagtcaagagaatgggggacagtgttttaggaattgcaacccagtgtatcaagtccaagaatgtgacccggacaactgcccagatgttgtcgaacctatgcttgaagatcaacgctaagctgggggggataaacaccatcctagttccagagaacaggatcaggatattcagtgagcctctgatgttccttggagctactgtgacccatcccccagctggagacacaaagaagccaagcattgctgctcttgttgcctcagttgatgctcatccatcattgtacagtgctgtagtcaggatacaaatggcaaggatggacgtgatcaatgctttgtatgagatggttaaagagtccttggtcaacttctatgtcaagactggattcaaacctcataggattgtgatgtaccgtgatggtgtttcagagggtcaatttgcttctgtacttcaaaacgaactgcttgccattaggaaagcttgtgtatccctggagacggattaccggcccggcatcaccttcattgttgtacagaagaggcatcacacacggctgttctgcgccaatccaagggatcagtcgggacggtccggtaatgtaccggcaggaaccactgtggattctaacatcactcacccaacagagaatgatttctatctctgttctcatcaaggaatccagggcactagtcgaccctcctactaccgttgtttgtgggatgataatcagctgactgctgatgaattgcagaccatgacctactctctctgccatacatacgccagatgtacaagaagtgtttctatccctgctcccgcttactacgctcatctagttgccatcagagcaagataccacatcataggcaattgatttgtttagatacca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]