GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-15 05:05:22, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_023330476            1332 bp    mRNA    linear   VRT 22-DEC-2017
DEFINITION  PREDICTED: Xiphophorus maculatus myb-like protein X (LOC111608070),
            mRNA.
ACCESSION   XM_023330476
VERSION     XM_023330476.1
DBLINK      BioProject: PRJNA220265
KEYWORDS    RefSeq.
SOURCE      Xiphophorus maculatus (southern platyfish)
  ORGANISM  Xiphophorus maculatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Ovalentaria; Atherinomorphae; Cyprinodontiformes;
            Poeciliidae; Poeciliinae; Xiphophorus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_036445.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Xiphophorus maculatus Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1332
                     /organism="Xiphophorus maculatus"
                     /mol_type="mRNA"
                     /strain="JP 163 A"
                     /isolation_source="from the 114th generation of
                     line-breeding"
                     /db_xref="taxon:8083"
                     /chromosome="3"
                     /sex="male"
                     /tissue_type="whole"
                     /dev_stage="adult"
     gene            1..1332
                     /gene="LOC111608070"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 78% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:111608070"
     CDS             67..1248
                     /gene="LOC111608070"
                     /codon_start=1
                     /product="myb-like protein X"
                     /protein_id="XP_023186244.1"
                     /db_xref="GeneID:111608070"
                     /translation="
MMTTNQLENIKTLTTDKKRLIEERKMMENQIEEVIRDRHLSVVRAGLTRERLTQEREELNKEREELRKKIDELSLEKEELSKKIDDLNNEKDELNKEKDELSKKTAELSSKTEELNKEKAELSKNTKDLNKKKLELNKEKDKLSEDKKEQSQEKEKLNKEKDELSKDKKELSNEKEKLNKEKDELSKEKKYLSTEKEELKKDKAELNKEREKLRVLTDEAENRCKNRDALKKFFNHVMRFRTFPVSEMCPLYMRTKCPACREKEPLYKGHCYWIYPYDIGLLTWYQGDIWCFDDGGSLVVIDDLEEQEFINNHTKRYKGDHGYWIGLRNVRNKWLWVDERRNTLDFWIKGIPHTSGAALHMSERKATESWRAEDIQRDNKIICERPMIVWPYN"
     misc_feature    187..>702
                     /gene="LOC111608070"
                     /note="Uncharacterized N-terminal coiled-coil domain of
                     peptidoglycan hydrolase CwlO [Function unknown]; Region:
                     CwlO1; COG3883"
                     /db_xref="CDD:443091"
     misc_feature    865..1218
                     /gene="LOC111608070"
                     /note="C-type lectin (CTL) or carbohydrate-recognition
                     domain (CRD); Region: CLECT; smart00034"
                     /db_xref="CDD:214480"
     misc_feature    order(1138..1140,1144..1146,1150..1152,1171..1173,
                     1177..1188,1195..1203)
                     /gene="LOC111608070"
                     /note="ligand binding surface [chemical binding]; other
                     site"
                     /db_xref="CDD:153057"
ORIGIN      
ttttgatgctctctgacacagatagattcactgactttctgactaatttgtgtgtttatagtgagtatgatgacgaccaatcagctggaaaatatcaaaacccttacaacagacaaaaagcgactgattgaggaacgaaagatgatggaaaaccagattgaggaggtgatccgagacagacacctgagcgtagtcagagcaggacttacccgagagaggcttactcaagagagagaggagctgaacaaagagagagaagagctgaggaaaaagattgacgagctgagcttagagaaagaagagctgagcaaaaagattgacgatctgaacaatgagaaagatgagctgaacaaagagaaagacgagctgagcaaaaaaacagcagagctgagcagcaagacagaggagctgaacaaagagaaagcagagctgagcaaaaacacaaaggacctgaacaaaaagaaactcgagcttaacaaagaaaaagacaagctgagtgaagacaaaaaggagcagagccaagaaaaagagaaactgaacaaagagaaagacgagctgagcaaagacaaaaaggagctgagcaacgagaaagagaaactgaacaaagagaaagacgagctgagcaaagagaaaaagtatctgagcacagagaaagaggagctgaagaaagataaagcagagctgaacaaagagagagagaagctgagagtattgacagacgaggcagagaaccgatgcaaaaacagagatgctctgaaaaagttcttcaatcacgtcatgagatttaggacatttccagtttcagagatgtgccctctatatatgagaacaaaatgtccggcttgcagggaaaaggagccattatacaagggacactgctactggatttatccatatgacattggtttgctaacctggtaccaaggtgacatctggtgttttgatgatggtggaagtttggttgtaattgatgatctggaggagcaggagtttatcaacaatcacaccaaaagatacaaaggtgaccatggatactggatagggttacgtaatgttcgaaacaaatggttgtgggttgatgaacgtaggaacactcttgatttctggataaaagggattccccatacttcaggagcagcactgcatatgtcagaaagaaaagccacagagagctggagagcagaagacatacagagagataacaaaatcatctgtgagcgtccgatgattgtttggccctacaactaacactgttctcttcaagtttcaatgaggaacactcaactgtgtcatcaaacttgaatctcataaataaaaacagacaaaaatttg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]