GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-06-02 01:18:15, GGRNA.v2 : RefSeq release 200 (May, 2020)

LOCUS       XM_023205440            3909 bp    mRNA    linear   PRI 30-DEC-2019
DEFINITION  PREDICTED: Piliocolobus tephrosceles NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X2,
            mRNA.
ACCESSION   XM_023205440
VERSION     XM_023205440.1
DBLINK      BioProject: PRJNA419387
KEYWORDS    RefSeq.
SOURCE      Piliocolobus tephrosceles (Ugandan red Colobus)
  ORGANISM  Piliocolobus tephrosceles
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Colobinae; Piliocolobus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045439.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Piliocolobus tephrosceles Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3909
                     /organism="Piliocolobus tephrosceles"
                     /mol_type="mRNA"
                     /isolate="RC106"
                     /isolation_source="whole blood"
                     /db_xref="taxon:591936"
                     /chromosome="6"
                     /sex="male"
                     /country="Uganda: Kibale National Park"
                     /lat_lon="0.4862 N 30.3897 E"
                     /collection_date="27-Jul-2014"
     gene            1..3909
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 mRNAs, 104 ESTs, 2 Proteins, and
                     99% coverage of the annotated genomic feature by RNAseq
                     alignments, including 22 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:111538208"
     CDS             234..3647
                     /gene="NRDE2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2 isoform X2"
                     /protein_id="XP_023061208.1"
                     /db_xref="GeneID:111538208"
                     /translation="
MALFPAFAGISEAPDSGSSRKELDWLSNPSFCVGSLTSLSQQTEAAPAHVSEGSPLTRSLLKSEPSDESDTNQKLKQISRKKKKEKKKKRKHQHHKKTKRKHGQSSSSSQGNNAAADTGHRFVWLEDIQAVTGETFRTDKKPDPANWEYKSLYRGDIARYKRKGDSCLGINPKKQCISWEGTSTEKKHSRKQVERYFTKKSVGLMNIDGAAISSKTEPPSSEPISFIPVKDLEDAAPVTTWLNPLGIYDQSTTQWLQGQGPPEQESKQPDTQPDSESAALKAKVEEFNRRVRENPRDTQLWMAFVAFQDEAMRSPGLYAIEEGEQEKRKRSLKLILEKKLAILERAIESNQSSVDLKLAKLKLCTEFWEPSTLVKEWQKLIFLHPNNTALWQKYLLFCQSQFSTFSISKIHSLYGKCLSTLSAVKDGSILSHPALPGTEEAMFALFLQQCHFLRQAGHSEKAVSLFQAMVDFTFFKPDSVKDLPTKGQVEFFEPFWDSGEPRAGEKGARGWKAWMHQQERGGWVVINPDEDDDEPEEDDQEIKDKTLPKWQIWLAAERSRDQRHWQPWRPDKTKKQTEEACEDPERQVLFDDIGQSLIRLSSHNLQFQLVEAFLQFLGVPSGLTPPASCLYLAMDENSIFDNGLYDEKPLTFFNPSFSGASCVGRMDRLGCPRWTRGQNREGEEFIRNVFHLVMPLFSGKEKSQLCFSWLQYEIAKVIWCLHTKNKKRLKSQGKNCKKLAKNLLKEPENRNNFCLWKQYAHLEWLLGNTEDARKVFDTALSMAGSRELKDSDLCELSLLYAELEVELSPEVRGAATARAVHILTKLTESSPCGPYTGQVLAVHILKARKAYEHALQDCLGDSCVSDPAPTDSCSRLISLAKCFMLFQYLTTGIDAAVRIYEQVFAKLNSYVFPEGSGEGDSASSQSWTSVLEAITLMHTSLLRFHMKVSVYPLAPLREALSQALKLYPGNQVLWRSYVQIQNKSHSASKTRRFFDTVTRSAKALEPWLFAIEAEKLRKRLVETVQRLDGREIHATIPEIGLTHRIQALFENAMRSDSGSQCPLLWRMYLNFLVSLGNKERSKGVFYKALQNCPWAKVLYLDAVEYFPDEMQEILDLMTEKELRVRLPLEELELLLED"
     misc_feature    1089..1907
                     /gene="NRDE2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:312057"
ORIGIN      
ccccttggccccgccctaccctgatttgccctgcctcgccctgccccgccgcgtccccgtcccttggccaccctcccctctgggccccgcccctcccgcttcggggtcaagccccagagagcttcgcgaaaaccacatttcccagagtgtaccgcgacggctggggtcctcacactggcgctcgctcgccgacgccatatctgtagagaggaactgcggtacggcctgtggtcatggcgctgttcccggccttcgcggggattagtgaggctcccgatagcgggagctccaggaaagagttagactggctgagcaacccaagcttttgtgttggatccctaacgtccctgagccaacagactgaagcagccccagcccatgtttctgaagggtcaccgctgacacggagtcttctgaaatcagagccttcagatgaaagtgacactaaccaaaagctcaaacaaataagcagaaaaaagaagaaagagaaaaagaagaaaaggaagcatcagcatcataagaaaacaaagaggaagcatgggcagtcgagtagcagcagtcaaggaaataatgctgcagctgatactggacatcgctttgtttggcttgaggacattcaggctgtgacgggagaaaccttcagaacagataagaaaccagatcctgcgaactgggagtacaagtctctctaccgaggggatatagcaagatacaagaggaaaggagactcctgccttggcattaaccctaagaagcagtgcatatcttgggaagggacttccacagagaagaagcattcacgcaagcaggttgaacgctattttactaagaagagtgtgggattaatgaacattgatggagctgccatcagcagtaaaactgaacctccctcatctgagcccatctcctttataccagtgaaggacttggaagatgcagctcctgttacaacctggttgaatcctctggggatttatgatcagtcaaccacacagtggctacaaggacagggtcctccagagcaggaatcaaagcagccagacacacagccagacagcgagagtgcggctctcaaggccaaggtggaggagtttaacaggagggtgcgggagaatcctcgggatacgcagctgtggatggcattcgttgcttttcaggacgaggccatgagaagtcctggcctgtatgccatcgaggaaggagagcaggaaaagcgaaagaggtccctgaagctcattctggagaagaagctggccattctggagcgggccattgagagcaaccagagcagtgtggatctgaaactggccaagctgaagctctgcacagagttctgggagccctccactctggtcaaagagtggcagaaactgatatttttgcatcccaataatacagccctttggcagaaataccttttattttgccagagccagtttagtaccttttcgatatcaaaaattcacagtctttatggaaaatgcttgagcactttgtctgctgttaaggacggcagcatcctatctcaccctgcgttgcctggcacggaagaggccatgtttgcactctttcttcagcagtgccactttctgcggcaggccggccactctgagaaggccgtctctttgttccaggccatggtggacttcaccttcttcaaacctgacagcgtgaaagatctgcctaccaaaggacaggtggaattctttgagcccttttgggacagtggagagccccgggctggggagaaaggagcccgaggctggaaggcatggatgcaccagcaggaacgaggtggctgggtggtcatcaacccagatgaggatgacgatgaaccagaagaggatgaccaggaaataaaagataagactctgcccaagtggcagatctggcttgctgctgagcgttcccgagaccagaggcactggcagccctggcgccctgataagaccaagaagcaaactgaggaagcctgtgaggatcccgagagacaggtgttgtttgatgatattgggcagtctttgatcagactttccagccacaatcttcagttccagctggtggaggccttcctgcagttcttgggtgtgccttctggccttactcctccagcctcctgtctttatctggctatggatgagaacagcatctttgataatggactttatgatgaaaagcccttgacttttttcaacccctcgttttccggggctagctgtgttggccgcatggatcggttgggctgtcctcgctggaccaggggtcagaaccgagagggcgaggagttcatccgcaatgtcttccaccttgtcatgcctttgttttcaggcaaagagaagtcccagctctgcttctcctggttacagtatgagattgcaaaggtaatttggtgtctgcacactaaaaacaagaagagattaaagtcacaagggaagaactgcaaaaaactagccaagaatctccttaaggagccagaaaaccgcaacaacttttgcctctggaagcagtatgcacatctagagtggttgcttggcaacacggaggatgccagaaaagtttttgacacagcactcagcatggcaggaagcagagaactgaaagactctgacctctgtgagctcagtctgctctatgctgagctggaggtggagctgtcgccggaagtgagaggcgccgccacggcccgagctgttcacatattaaccaagctgactgagagcagcccctgtgggccctacactggacaggtgttggctgttcacattctgaaagcgcgaaaggcttacgagcacgcgctgcaggactgtttgggtgacagctgtgtctccgatccagctcccaccgattcctgtagccgcctaattagcttggctaaatgcttcatgctcttccagtatttgaccacagggattgatgctgctgtgcggatatacgaacaggtatttgcaaaactgaacagttacgttttcccagaaggctctggcgagggggacagtgccagctcccagagttggaccagtgttcttgaagccatcacactgatgcacacgagcctgctgagattccacatgaaagtgagtgtttacccgctcgcccctctgcgagaggcactctcacaggctttaaagttgtatccgggcaaccaggttctttggaggtcctatgtacagattcagaataagtcccacagtgccagcaagaccaggagattttttgacacagtcaccaggtctgccaaagccttggagccttggttgtttgcaattgaagctgagaaactgaggaagagactggtggaaactgtccagaggttagacggtagagagatccatgccacaattcctgagatcggcttaacacatcggatccaagccctgtttgaaaacgccatgcgcagcgacagtggcagccagtgccccttgctgtggaggatgtatttgaactttctggtttccttaggaaataaagaaagaagcaaaggtgtattctacaaagcacttcagaattgtccttgggcaaaggtgttatacctggacgccgtggagtacttccccgacgagatgcaggagatcctggacctgatgactgagaaggagctccgggtacgcctgccgctggaggagctggagctgctgctggaggattagagggcagcaaggccaagccgcccaccctgcagagctaggaggtgtgagcggagaatatgtgtgttaggagacctcagcttttgagatattctttcttgatagtaataatgtgggctgccagcctcttcacatcttgcacactttttgggtgtgtaaatgacacaaaagctatttacatattatatatgtgaatatgtgtatatttgtatatagccagagagtcatgccaaggggtcattaaaccgatgatgattgaggtgtg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]