ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-05-16 18:04:58, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_022954129 2488 bp mRNA linear INV 25-OCT-2017 DEFINITION PREDICTED: Stylophora pistillata protein argonaute-2-like (LOC111346866), mRNA. ACCESSION XM_022954129 VERSION XM_022954129.1 DBLINK BioProject: PRJNA415215 KEYWORDS RefSeq. SOURCE Stylophora pistillata ORGANISM Stylophora pistillata Eukaryota; Metazoa; Cnidaria; Anthozoa; Hexacorallia; Scleractinia; Astrocoeniina; Pocilloporidae; Stylophora. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_019218982.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Stylophora pistillata Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2488 /organism="Stylophora pistillata" /mol_type="mRNA" /isolate="CSM Monaco" /isolation_source="northern Red Sea" /db_xref="taxon:50429" /chromosome="Unknown" /tissue_type="whole animal" /geo_loc_name="Jordan: Aqaba" /collection_date="01-Jan-1995" /note="holotype #3, clade 4" gene 1..2488 /gene="LOC111346866" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 20 Proteins, and 94% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:111346866" CDS 32..2419 /gene="LOC111346866" /codon_start=1 /product="protein argonaute-2-like" /protein_id="XP_022809864.1" /db_xref="GeneID:111346866" /translation="
MQPPKRPDYGTKGRLIALRANFLCLNTSPELSDLYHYDVEITPDKCPKEIKRDIVNEAIKKYKNTVFQGHHPAFDGERNLYSRIELPVRVKLNVQLPGGDGGRDRHLEVRIQFAGSVSLLELNNFLSGKQDVKRPHGTVQALNTVVRQMPSLSNTSVGKLLFPIGGQGRFLGEGCERKFGFTLSVRPSGWKAMLVNIDVSAKGFYKELAVVPDFLYDTLGLKLNNLKDCKYEVDRGKLEKVICGLRIQTTHAASIKRKYRVWGVSAKSAERMQFDVTDEGTGRTYKTTVAEYFKDRHKVTLRYPHLPCLRVGQKKGTYLPLEVCTVIPCERKHLSEQQITNMIRSTARPAPEQQRDIQHWAQEMTRESNEYLRNEFQTSLNSEMVKVEGHVLPAPRINLGPQDLPLVPRDGSWDMRNKSLHDGARIDQWALACFDRGCREEQLRNFSGQMANVSSRQGLRMSEQPVVVAYGRGIRDVESLFSKWVVDFPGLQLIMAVLPERDKQIYPELKRVGDNVIGIPTQGVQSKNVYSCKPHLCANLALKINSKLGGINHVIAAVVASMDANATKYYARVRAQNHRNGKAAQEIINDLAAMVRELLIEFYKANRKLKPSKIIFYRDGVSEGKFDQVLVHEVRAVQQACMDLEKAYRPRITFVVVQKRHHTRLYCENQRDEVGKARNVPPGTTVDSGITHPYEFDFYLCSHNGIQGTSRPKHYHVLYDDNSFTADALQQLTYQLCHLYARSTRSVSMPAPAYFAHLVAFRARHHVTGNGSVDLENTTKAIEVNAKMKGAMYFT"
misc_feature 239..469
/gene="LOC111346866"
/note="N-terminal domain of argonaute; Region: ArgoN;
pfam16486"
/db_xref="CDD:465134"
misc_feature 497..649
/gene="LOC111346866"
/note="Argonaute linker 1 domain; Region: ArgoL1;
pfam08699"
/db_xref="CDD:462567"
misc_feature <731..1012
/gene="LOC111346866"
/note="PAZ domain, argonaute_like subfamily. Argonaute is
part of the RNA-induced silencing complex (RISC), and is
an endonuclease that plays a key role in the RNA
interference pathway. The PAZ domain has been named after
the proteins Piwi,Argonaut, and Zwille; Region:
PAZ_argonaute_like; cd02846"
/db_xref="CDD:239212"
misc_feature order(806..808,851..853,896..898,908..910,962..964,
980..982,986..988)
/gene="LOC111346866"
/note="nucleic acid-binding interface [nucleotide
binding]; other site"
/db_xref="CDD:239212"
misc_feature 1151..2329
/gene="LOC111346866"
/note="PIWI domain, Argonaute-like subfamily. Argonaute is
the central component of the RNA-induced silencing complex
(RISC) and related complexes. The PIWI domain is the
C-terminal portion of Argonaute and consists of two
subdomains, one of which provides the...; Region:
Piwi_ago-like; cd04657"
/db_xref="CDD:240015"
misc_feature order(1547..1549,1559..1561,1595..1606,1613..1615,
1637..1639,1646..1648,1658..1660,1670..1672)
/gene="LOC111346866"
/note="5' RNA guide strand anchoring site [active]"
/db_xref="CDD:240015"
ORIGIN
cactactggtcagattctaagaaacagtggaatgcaacctccaaaaagaccagattatggcacaaaaggccgccttatagctttgagggcaaacttcctctgcctaaatacatcaccggagctttcagacctgtatcactatgatgttgaaataactccagacaaatgtcccaaagaaataaagagggacattgttaatgaagccataaagaaatacaaaaatacagtatttcaaggccaccatcctgcttttgatggtgaaaggaacttgtacagtaggatagaactgcctgttcgtgttaaacttaacgttcaactacctggaggggatggaggtagagacagacatttggaggtcagaattcagtttgctggttcagtgagtcttttggaacttaacaactttttgagtggaaaacaagatgtcaaaagacctcatggtacagtacaggccctaaacactgtggtgcgtcagatgccgtcattgtctaacacctctgttggaaaattattatttccaattggtggtcaaggaagattcctgggagaggggtgtgagcggaaatttggttttactttaagtgttcggccttctggttggaaggccatgctggtgaacattgatgtctctgcaaagggattttacaaggagcttgctgttgttcctgacttcttgtatgacaccctcgggttaaaactgaataacctcaaagactgcaaatatgaagtggatagaggaaagcttgaaaaagttatatgtggacttcgtattcaaactactcatgctgcctctattaagaggaagtacagagtttggggcgtgtcagcaaaatcggccgaaaggatgcagtttgatgttacagatgagggaacaggtcgcacatacaaaacaactgtcgcagagtatttcaaggacagacacaaggtgacattgaggtatcctcatctgccgtgcttacgagttggacagaaaaagggcacgtatctgccactggaggtctgtaccgttattccttgtgaaaggaaacatttatctgaacaacagattacgaacatgatcagaagtactgctcgccctgcacctgagcaacagcgtgacattcaacactgggcccaagaaatgactcgagaaagtaacgagtatctaagaaatgagttccaaacctcactcaactcagagatggttaaggtagaaggacatgtgcttccagcacccagaatcaaccttggaccccaggatctgccattggttcctcgtgatggctcatgggatatgcgcaacaaatcactgcatgatggagcccgtattgatcagtgggcattggcttgttttgacaggggatgtcgggaagaacagctgagaaatttttctgggcaaatggcgaatgtatccagtcgacagggtttgagaatgtcagagcagccagttgttgtggcatacggcaggggcataagagatgttgagagtttgttttctaagtgggtagtagattttccaggcttacaacttatcatggctgttctgccagagagagacaaacaaatctatccagagttaaaacgtgttggcgacaatgttatcggaattccaacgcagggtgtacagtcaaaaaatgtatacagttgtaaacctcacctttgcgccaatctcgcgttgaagatcaactccaaacttggaggaatcaaccatgtaattgctgctgttgtggcaagtatggatgccaatgccacaaagtactatgcacgagtgcgagcacagaaccacagaaatggaaaagcagctcaagaaataattaatgacttggcggctatggtgagagagcttcttattgagttttacaaagccaatcggaagcttaagcctagcaagatcatcttctaccgagatggagtcagcgagggtaaatttgaccaagtacttgttcatgaagtgcgagccgtgcaacaggcctgtatggatcttgaaaaagcttatcgcccaagaatcacctttgtggtggttcagaagcgccatcatacgagattgtactgtgaaaaccaacgagatgaagttggaaaagcaagaaatgttcctcctggtacaactgtggacagcggtatcacgcatccttacgagttcgacttttatctgtgcagccataatggaatccagggaacaagccgacccaagcactaccatgtgttatatgacgataactcattcacagcggacgcccttcagcagctcacgtaccagctgtgtcacttgtacgcaaggagcacgcgtagcgtctccatgccagcccccgcctattttgcccacttggtggcctttagagctagacaccacgtgaccggaaatggaagtgttgacctggagaacactacaaaagccatcgaagtcaacgctaagatgaaaggagccatgtactttacttaaaatattaataaaatattaataaaatatcacgtatcgtgatattttattaatattttattaatgtattat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]