2025-10-16 16:53:29, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_022576292 3313 bp mRNA linear MAM 16-SEP-2019 DEFINITION PREDICTED: Delphinapterus leucas NRDE-2, necessary for RNA interference, domain containing (NRDE2), transcript variant X2, mRNA. ACCESSION XM_022576292 VERSION XM_022576292.1 DBLINK BioProject: PRJNA407951 KEYWORDS RefSeq. SOURCE Delphinapterus leucas (beluga whale) ORGANISM Delphinapterus leucas Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Whippomorpha; Cetacea; Odontoceti; Monodontidae; Delphinapterus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_022098016.1) annotated using gene prediction method: Gnomon, supported by mRNA evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Delphinapterus leucas Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3313 /organism="Delphinapterus leucas" /mol_type="mRNA" /isolate="GAN/ISIS: 26980492/103006" /db_xref="taxon:9749" /chromosome="Unknown" /sex="female" /tissue_type="blood" /dev_stage="adult" gene 1..3313 /gene="NRDE2" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 mRNAs, 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 27 samples with support for all annotated introns" /db_xref="GeneID:111176165" CDS 36..3203 /gene="NRDE2" /codon_start=1 /product="protein NRDE2 homolog isoform X2" /protein_id="XP_022432000.1" /db_xref="GeneID:111176165" /translation="
MALFPAFAGVSEEPESGSPRKELDWLSNPSFCAGTITSLSQQTEEVTAFVSEESLLTRSPLNSEPSDESDTNKKPKQTSRKKKKEKKKKRKHQHRKKTKRKRGQSSSSGSESYTDSEKDISSRSIRSSKKESEKPNQENNATADIGRHFVWLEDIQALTGETFRTDKKPDPANWEYKSLYRGDVARYKRKGDSCLGINPRKQCISWEGTSTEKKRSHKPVERYFTKKSVGLMNIDGVAISSKTEPPSSESISFIPVKGAEDVVSPVTTWLNPLGIYDEATTQWLQGRGPSEQESKQPDSQPNKENVLLKAKVEEFNRRVWENPRDIQLWMAFVAFQDEVMRSPGLYAIEEGQQEKQKRSLRLVLEKKLAILERAVESNPSSVDLKLAKLQLCTEFWEPATLVKEWQKLIFLHPNNTALWQKYLLFCQSQFSTFSISKIQSLYGKCLSTLSAVKDGSILSHPELPGTEEAMFALFLQQCHFLRQAGHSEKAVSLFQAMVDFTFFKPDSVKDLPTKGQVEFFEPFWDSGEPRAGEKGARGWRAWMQQQERGGWVVVSPDDDDDEPEDDDQEIKDKTLPRWQIWLAAERSRDHRHWRPWRPEKTKKQAEEDCEDPERQVLFDDIGQSLIQLSSPDLQFRLIAAFLQFLGVPSGFSPPASCLYLAMDENSIFDNGLYDEQPLTFLNLSFSGVSCVGRTDQLGCRHWTRGHSREGEEFIRSIFHLVMPLFSGKERSQLCFSWLRYEIAKVVWCLHTKNKKRLKSQGKNCKKLAKNLLKEPDNRNNFCLWKQYAHLEWLLGNTEDARRVFDTALGMAGSRELKDHELCELGLLYAELEVELLPDVRGAAPARAIHVLTRLTENGAYGPYTGQVLAIHILKARKAYEHALQDCLGESCVSDPAPADSFSRLISLVKCFMLFQYLTIGIDAAVRIYEQVFVKHKVSVSAEGPGLEGSASSRSLSSVLEAVTLMHTSLLRFHMKVAVYPLAPLREALSEALKLYPDNQVLWRSYVQIQNKSHSASKTRRFFDAITRSAKPLEPWLFAIEAEKMRKRLVETVQRW"
misc_feature 519..806 /gene="NRDE2" /note="MTR4-interacting domain (MID) found in nuclear exosome regulator NRDE2 and similar proteins; Region: NRDE2_MID; cd22200" /db_xref="CDD:412062" misc_feature order(519..545,552..557,567..572,576..578,582..626, 633..641,645..653,675..683,693..698,702..707,714..734, 759..770,780..806) /gene="NRDE2" /note="MTR4 binding site [polypeptide binding]; other site" /db_xref="CDD:412062" misc_feature 975..1973 /gene="NRDE2" /note="necessary for RNA interference; Region: NRDE-2; pfam08424" /db_xref="CDD:462472" ORIGIN
ttttgtggagtgaaaaggcggtgtggcctgtgatcatggcgctgttccccgcctttgcgggtgttagtgaggagcccgagagcgggagccccaggaaagaattagactggctgagcaacccaagcttttgtgctggaaccataacatctctgagccaacaaactgaagaggtcacagcctttgtttctgaagagtcgctactgaccaggagtcctctgaattcagagccttcagatgaaagtgacactaacaaaaagcccaaacaaacaagcagaaaaaagaagaaagagaaaaagaagaaaaggaagcatcagcaccgcaagaaaaccaagagaaaacgtgggcagtcaagtagcagtggatctgagtcatatactgattctgaaaaagacatatcttccagaagcatcagaagcagtaaaaaggaatcagagaaaccgaatcaagaaaataatgccactgctgatattggacgtcactttgtttggcttgaggacatccaggctctgacgggagaaaccttcagaacagataagaagccggatcctgcaaactgggagtataagtctctttaccgaggagatgtagcaagatacaagaggaaaggagactcctgccttggcattaaccctaggaagcagtgtatatcttgggaggggacttccacagaaaagaagcggtcacacaagcctgtcgagcgctactttacaaagaagagtgtgggattaatgaacattgacggagttgccattagcagtaaaactgaacctccctcatcagagtcgatctcatttatcccagtgaagggtgcagaggatgtggtttcccctgttacaacctggttgaaccctctggggatttatgatgaagccaccacgcagtggttacaaggccggggtccttcagagcaagaatccaagcagccagattcacagcccaacaaagagaatgtgcttctcaaggccaaggtggaggagtttaacaggagggtttgggagaatcctcgggatattcagctgtggatggcatttgttgcttttcaggacgaggtcatgagaagtccgggcctgtacgccatcgaggaaggacagcaggaaaagcagaagcggtccctgaggctggttctggagaagaagctggccattctggaacgggccgtggaaagcaacccgagcagcgtggatctgaaacttgccaagctgcagctctgcactgagttctgggagcccgccactctggtcaaagagtggcagaaactgatatttttacatcccaacaatacagccctttggcagaaataccttttattttgccagagccagtttagcaccttttccatatcaaaaattcagagtctttatggaaaatgcttgagtactttgtctgctgttaaggacggcagcatcttgtctcaccccgagctgcctggcactgaggaggccatgtttgccctctttcttcagcagtgccactttctgcggcaggctggtcactccgagaaggccgtctctctgttccaggccatggttgacttcaccttcttcaaacccgacagtgtgaaagacctgcctaccaaaggacaggtagaattctttgagcccttttgggacagtggagagcccagggccggggagaagggcgcccgaggctggagagcgtggatgcagcagcaggagcggggcggctgggtggtcgtcagcccagatgatgacgatgatgaaccagaagacgacgaccaggaaattaaagataagactctgcccaggtggcagatctggcttgctgctgagcggtcccgagaccacagacactggcggccgtggcgccctgagaagaccaagaagcaggcggaggaagactgtgaggacccggagaggcaggtgttgtttgatgatattggacagtctctgatccagctttccagcccggatcttcagtttcggctgattgcagcctttctgcagttcttgggtgtgccttccggcttcagccctccggcctcctgcctctatctggccatggatgagaacagcatctttgacaatggactttatgatgaacagcccttgacttttctcaacctttcattttccggcgtcagctgtgtcggacgcacggaccagctgggttgccggcactggaccaggggtcacagtcgagagggcgaggagttcatccgcagcatcttccacctcgtgatgcctttgttttcagggaaggagaggtctcagctctgcttctcctggttacggtacgagattgcaaaggtcgtttggtgtctgcacactaaaaacaagaagagattaaaatcacaaggaaagaactgcaaaaaactagccaagaatctcctcaaggagccagacaaccgcaacaatttttgcctctggaagcagtatgcgcatctggagtggttgctcggcaacacagaggacgccagaagagttttcgatacagcactcggcatggcagggagcagagaactgaaggaccatgagctgtgtgagcttggtctcctctacgccgagctggaggtggagctgttgccggacgtgagaggggccgccccagcccgagccattcacgtattgaccagactgaccgagaatggggcctacgggccctacaccgggcaagtcttggccattcacattttgaaagctcggaaggcttatgaacacgcgctgcaggactgtttgggggagagctgtgtctccgatccagctcccgccgattcctttagccgcctgattagcctggttaaatgctttatgctcttccagtatttgaccatagggatcgacgctgctgtgcggatatatgagcaggtatttgtgaaacacaaggtctctgtttccgcagagggccctggtctggagggcagtgccagctcccggagcctgagcagtgtccttgaggccgtcaccctgatgcacacgagcctgcttagattccacatgaaagtcgccgtctaccctctggctcctctgcgagaggctctctcggaggctttaaagttgtatccggacaaccaggttctttggaggtcgtatgtacagattcagaataagtcccacagtgccagtaagaccagaagattcttcgatgcgatcaccaggtctgccaaacccttggagccgtggttgttcgcaattgaagctgagaaaatgaggaaaagactagtggaaactgtgcagagatggtagagaagtctacgccaccattcccgagaccggcctgacacatcggatcagagccctgtttgaaaatgcgatgcggagtgactacggcagccagtgccccttactgtggagaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]