GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-19 08:23:00, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_022576291            3822 bp    mRNA    linear   MAM 16-SEP-2019
DEFINITION  PREDICTED: Delphinapterus leucas NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X1,
            mRNA.
ACCESSION   XM_022576291
VERSION     XM_022576291.1
DBLINK      BioProject: PRJNA407951
KEYWORDS    RefSeq.
SOURCE      Delphinapterus leucas (beluga whale)
  ORGANISM  Delphinapterus leucas
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Whippomorpha;
            Cetacea; Odontoceti; Monodontidae; Delphinapterus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022098016.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Delphinapterus leucas Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3822
                     /organism="Delphinapterus leucas"
                     /mol_type="mRNA"
                     /isolate="GAN/ISIS: 26980492/103006"
                     /db_xref="taxon:9749"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..3822
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 7 mRNAs, 9 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 27 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:111176165"
     CDS             36..3533
                     /gene="NRDE2"
                     /codon_start=1
                     /product="protein NRDE2 homolog isoform X1"
                     /protein_id="XP_022431999.1"
                     /db_xref="GeneID:111176165"
                     /translation="
MALFPAFAGVSEEPESGSPRKELDWLSNPSFCAGTITSLSQQTEEVTAFVSEESLLTRSPLNSEPSDESDTNKKPKQTSRKKKKEKKKKRKHQHRKKTKRKRGQSSSSGSESYTDSEKDISSRSIRSSKKESEKPNQENNATADIGRHFVWLEDIQALTGETFRTDKKPDPANWEYKSLYRGDVARYKRKGDSCLGINPRKQCISWEGTSTEKKRSHKPVERYFTKKSVGLMNIDGVAISSKTEPPSSESISFIPVKGAEDVVSPVTTWLNPLGIYDEATTQWLQGRGPSEQESKQPDSQPNKENVLLKAKVEEFNRRVWENPRDIQLWMAFVAFQDEVMRSPGLYAIEEGQQEKQKRSLRLVLEKKLAILERAVESNPSSVDLKLAKLQLCTEFWEPATLVKEWQKLIFLHPNNTALWQKYLLFCQSQFSTFSISKIQSLYGKCLSTLSAVKDGSILSHPELPGTEEAMFALFLQQCHFLRQAGHSEKAVSLFQAMVDFTFFKPDSVKDLPTKGQVEFFEPFWDSGEPRAGEKGARGWRAWMQQQERGGWVVVSPDDDDDEPEDDDQEIKDKTLPRWQIWLAAERSRDHRHWRPWRPEKTKKQAEEDCEDPERQVLFDDIGQSLIQLSSPDLQFRLIAAFLQFLGVPSGFSPPASCLYLAMDENSIFDNGLYDEQPLTFLNLSFSGVSCVGRTDQLGCRHWTRGHSREGEEFIRSIFHLVMPLFSGKERSQLCFSWLRYEIAKVVWCLHTKNKKRLKSQGKNCKKLAKNLLKEPDNRNNFCLWKQYAHLEWLLGNTEDARRVFDTALGMAGSRELKDHELCELGLLYAELEVELLPDVRGAAPARAIHVLTRLTENGAYGPYTGQVLAIHILKARKAYEHALQDCLGESCVSDPAPADSFSRLISLVKCFMLFQYLTIGIDAAVRIYEQVFVKHKVSVSAEGPGLEGSASSRSLSSVLEAVTLMHTSLLRFHMKVAVYPLAPLREALSEALKLYPDNQVLWRSYVQIQNKSHSASKTRRFFDAITRSAKPLEPWLFAIEAEKMRKRLVETVQRVDGREVYATIPETGLTHRIRALFENAMRSDYGSQCPLLWRMYLNFLVSLGNKERSKGVFYKALQNCPWAKVLYLDAVEYFPDEMQEILDLMTEKELRVRLPLEELELLLED"
     misc_feature    519..806
                     /gene="NRDE2"
                     /note="MTR4-interacting domain (MID) found in nuclear
                     exosome regulator NRDE2 and similar proteins; Region:
                     NRDE2_MID; cd22200"
                     /db_xref="CDD:412062"
     misc_feature    order(519..545,552..557,567..572,576..578,582..626,
                     633..641,645..653,675..683,693..698,702..707,714..734,
                     759..770,780..806)
                     /gene="NRDE2"
                     /note="MTR4 binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:412062"
     misc_feature    975..1973
                     /gene="NRDE2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:462472"
ORIGIN      
ttttgtggagtgaaaaggcggtgtggcctgtgatcatggcgctgttccccgcctttgcgggtgttagtgaggagcccgagagcgggagccccaggaaagaattagactggctgagcaacccaagcttttgtgctggaaccataacatctctgagccaacaaactgaagaggtcacagcctttgtttctgaagagtcgctactgaccaggagtcctctgaattcagagccttcagatgaaagtgacactaacaaaaagcccaaacaaacaagcagaaaaaagaagaaagagaaaaagaagaaaaggaagcatcagcaccgcaagaaaaccaagagaaaacgtgggcagtcaagtagcagtggatctgagtcatatactgattctgaaaaagacatatcttccagaagcatcagaagcagtaaaaaggaatcagagaaaccgaatcaagaaaataatgccactgctgatattggacgtcactttgtttggcttgaggacatccaggctctgacgggagaaaccttcagaacagataagaagccggatcctgcaaactgggagtataagtctctttaccgaggagatgtagcaagatacaagaggaaaggagactcctgccttggcattaaccctaggaagcagtgtatatcttgggaggggacttccacagaaaagaagcggtcacacaagcctgtcgagcgctactttacaaagaagagtgtgggattaatgaacattgacggagttgccattagcagtaaaactgaacctccctcatcagagtcgatctcatttatcccagtgaagggtgcagaggatgtggtttcccctgttacaacctggttgaaccctctggggatttatgatgaagccaccacgcagtggttacaaggccggggtccttcagagcaagaatccaagcagccagattcacagcccaacaaagagaatgtgcttctcaaggccaaggtggaggagtttaacaggagggtttgggagaatcctcgggatattcagctgtggatggcatttgttgcttttcaggacgaggtcatgagaagtccgggcctgtacgccatcgaggaaggacagcaggaaaagcagaagcggtccctgaggctggttctggagaagaagctggccattctggaacgggccgtggaaagcaacccgagcagcgtggatctgaaacttgccaagctgcagctctgcactgagttctgggagcccgccactctggtcaaagagtggcagaaactgatatttttacatcccaacaatacagccctttggcagaaataccttttattttgccagagccagtttagcaccttttccatatcaaaaattcagagtctttatggaaaatgcttgagtactttgtctgctgttaaggacggcagcatcttgtctcaccccgagctgcctggcactgaggaggccatgtttgccctctttcttcagcagtgccactttctgcggcaggctggtcactccgagaaggccgtctctctgttccaggccatggttgacttcaccttcttcaaacccgacagtgtgaaagacctgcctaccaaaggacaggtagaattctttgagcccttttgggacagtggagagcccagggccggggagaagggcgcccgaggctggagagcgtggatgcagcagcaggagcggggcggctgggtggtcgtcagcccagatgatgacgatgatgaaccagaagacgacgaccaggaaattaaagataagactctgcccaggtggcagatctggcttgctgctgagcggtcccgagaccacagacactggcggccgtggcgccctgagaagaccaagaagcaggcggaggaagactgtgaggacccggagaggcaggtgttgtttgatgatattggacagtctctgatccagctttccagcccggatcttcagtttcggctgattgcagcctttctgcagttcttgggtgtgccttccggcttcagccctccggcctcctgcctctatctggccatggatgagaacagcatctttgacaatggactttatgatgaacagcccttgacttttctcaacctttcattttccggcgtcagctgtgtcggacgcacggaccagctgggttgccggcactggaccaggggtcacagtcgagagggcgaggagttcatccgcagcatcttccacctcgtgatgcctttgttttcagggaaggagaggtctcagctctgcttctcctggttacggtacgagattgcaaaggtcgtttggtgtctgcacactaaaaacaagaagagattaaaatcacaaggaaagaactgcaaaaaactagccaagaatctcctcaaggagccagacaaccgcaacaatttttgcctctggaagcagtatgcgcatctggagtggttgctcggcaacacagaggacgccagaagagttttcgatacagcactcggcatggcagggagcagagaactgaaggaccatgagctgtgtgagcttggtctcctctacgccgagctggaggtggagctgttgccggacgtgagaggggccgccccagcccgagccattcacgtattgaccagactgaccgagaatggggcctacgggccctacaccgggcaagtcttggccattcacattttgaaagctcggaaggcttatgaacacgcgctgcaggactgtttgggggagagctgtgtctccgatccagctcccgccgattcctttagccgcctgattagcctggttaaatgctttatgctcttccagtatttgaccatagggatcgacgctgctgtgcggatatatgagcaggtatttgtgaaacacaaggtctctgtttccgcagagggccctggtctggagggcagtgccagctcccggagcctgagcagtgtccttgaggccgtcaccctgatgcacacgagcctgcttagattccacatgaaagtcgccgtctaccctctggctcctctgcgagaggctctctcggaggctttaaagttgtatccggacaaccaggttctttggaggtcgtatgtacagattcagaataagtcccacagtgccagtaagaccagaagattcttcgatgcgatcaccaggtctgccaaacccttggagccgtggttgttcgcaattgaagctgagaaaatgaggaaaagactagtggaaactgtgcagagggtagatggtagagaagtctacgccaccattcccgagaccggcctgacacatcggatcagagccctgtttgaaaatgcgatgcggagtgactacggcagccagtgccccttactgtggagaatgtatttgaattttttggtttccttaggaaataaagaaagaagcaaaggtgtgttctacaaagcacttcagaattgtccttgggcaaaggtgctgtacctggatgccgtggagtacttccccgatgagatgcaggagatcctggacctgatgacggagaaggagctccgggtgcgcctgccgctggaggagctggagcttctgcttgaggactagagaccaggaggggagtggggtgtgcctccgaggcctcggcgccggccccgtgggagcaggagataccagaagagacggtgacacatgcatgcgagtgtgttaagacctctgcctttggagtttctttcttgatagtttgtgtctgggttattggtctctcacctcttgcacattgtttgtgtgtgcaaatgacacagaagccatcgttttgcatattatatatgtatgtgtatatatgtgcatagacaggaatcatgctaagtgataaatgaacctgtcatggttggtg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]