GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 23:16:59, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_022575226            2808 bp    mRNA    linear   MAM 16-SEP-2019
DEFINITION  PREDICTED: Delphinapterus leucas argonaute RISC component 1 (AGO1),
            transcript variant X3, mRNA.
ACCESSION   XM_022575226
VERSION     XM_022575226.2
DBLINK      BioProject: PRJNA407951
KEYWORDS    RefSeq.
SOURCE      Delphinapterus leucas (beluga whale)
  ORGANISM  Delphinapterus leucas
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Cetartiodactyla; Cetacea;
            Odontoceti; Monodontidae; Delphinapterus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022098066.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 16, 2019 this sequence version replaced XM_022575226.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Delphinapterus leucas Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2808
                     /organism="Delphinapterus leucas"
                     /mol_type="mRNA"
                     /isolate="GAN/ISIS: 26980492/103006"
                     /db_xref="taxon:9749"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..2808
                     /gene="AGO1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 4 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 7 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:111175575"
     CDS             195..2705
                     /gene="AGO1"
                     /codon_start=1
                     /product="protein argonaute-1 isoform X3"
                     /protein_id="XP_022430934.1"
                     /db_xref="GeneID:111175575"
                     /translation="
MEAGPSGAAAGTYLPPLQQVFQAPRRPGIGTVGKPIKLLANYFEVDIPKIDVYHYEVDIKPDKCPRRVNREVVEYMVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWLAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERVSEGLRKPPIPLSCLLSLNMEEALEIKSGVLVLGLSIFPGPFLPLSSCGPSSAASFPLFPPSPLLPLYFISLLLAPWPIDPIYRPAPREGKGNFHLLNFSYVPDTVQGVFLTAAL"
     misc_feature    294..686
                     /gene="AGO1"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:318646"
     misc_feature    714..866
                     /gene="AGO1"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:312283"
     misc_feature    867..1229
                     /gene="AGO1"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1023..1025,1068..1070,1110..1112,1122..1124,
                     1176..1178,1197..1199,1203..1205)
                     /gene="AGO1"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1362..>2369
                     /gene="AGO1"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1773..1775,1785..1787,1821..1832,1839..1841,
                     1863..1865,1872..1874,1884..1886,1896..1898)
                     /gene="AGO1"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
ORIGIN      
gctgggggagctgctgcaggctccgcggcggcggctgcaacggaggctgcgggggcggcggcgcgagcggccgggcttgggggggtagccgagcccggcccgggagcccaagcagctaaagtgcggggtacctaggcccttcacgctggactccacagtctccgggccgcctgacctccgcacgggtatatgggatggaagcgggaccctcgggagcagctgcaggcacctacctgccccccctgcagcaggtgttccaggcacctcgtcggcctggcattggcaccgtggggaaaccaatcaagcttctggccaactactttgaagtggacatccctaagattgacgtctaccactacgaggtggatatcaagccggataagtgtcctcgcagagtcaaccgggaagtggtggaatacatggtccagcatttcaagcctcagatctttggtgatcgcaagcccgtgtatgatggaaagaagaacatttacactgtcacagcactgcccattggcaatgaacgggttgacttcgaggtgacaatccctggggaagggaaggatcgaatcttcaaggtctccatcaagtggctagccattgtgagctggcgcatgctgcatgaggccttggttagtggccagatccccgttcccctggagtctgtgcaagccctggatgtggccatgaggcacctggcatccatgaggtacacccctgtgggccgctccttcttctcaccgcctgagggctactaccacccgctggggggtgggcgcgaggtctggttcggctttcaccagtctgtgcgccctgccatgtggaagatgatgctcaacattgatgtctcagccactgccttctacaaggcgcagccagtgattgagttcatgtgtgaggtgctggacatcaggaacatagatgagcagcccaagcccctcacggactctcagcgtgtgcgcttcaccaaggagatcaagggcctgaaggtggaagtgacccactgtggacagatgaagaggaaataccgcgtgtgtaatgttacccgccgccctgccagccatcagacgtttcccttgcagctggagagtggacagactgtggagtgcacagtggcacagtatttcaagcagaaatataaccttcagctcaagtatccccacctgccctgcctgcaagttggccaggaacaaaagcatacctacctgcccctagaggtctgtaacattgtggctgggcagcgctgcattaagaagctgactgacaaccagacttcaaccatgataaaggctacagctagatcggccccagacagacaagaggagatcagccgcctgatgaagaatgccagctacaacctagatccctacatccaggaatttgggatcaaggtgaaggatgacatgacggaggtgacggggcgagtgctgccggcgcccatcttgcagtacggcggccggaaccgggccattgccacacccaatcaaggtgtctgggacatgcgggggaaacagttctacaatggaattgagatcaaagtctgggccattgcctgcttcgcaccccaaaaacagtgtcgagaagaagtgctcaagaacttcacagaccagctgcggaagatttccaaggatgcagggatgcccatccagggccagccttgcttctgcaaatatgcgcagggggcagacagcgtggagcccatgttccggcatctcaagaacacctactcagggctgcagctcattatcgtcatcctgccagggaagacgccagtgtatgctgaagtgaaacgtgttggagatacactcttgggaatggctacacagtgtgtgcaagtgaagaatgtggtcaagacctcgcctcagactctgtccaacctttgcctgaagatcaatgtcaaacttggtggcattaacaacatcctagttccacaccaacgctctgctgtctttcaacaaccagtgatattcctgggagcagatgttacacaccccccagcaggggatgggaaaaaaccttctatcacagcagtggtaggcagtatggatgcccaccccagccgttactgtgctactgtgcgggtgcagcgacctcggcaggagatcattgaagacttatcctacatggtacgggagctgctcatccagttctacaagtccacccgcttcaagcctacccgcatcatcttctaccgagatggggttcctgaaggccagctcccccagatcctccactatgagctgctggccattcgtgatgcctgcatcaaactggaaaaggactaccagcccgggatcacttatattgtggtgcagaaacgccatcacacccgccttttttgtgctgacaagaatgagcgagtgagtgagggattgaggaagccacccatacccttatcttgtctcctttctcttaatatggaagaagcccttgaaataaaatctggggttttagtccttggcctgtccatcttccctggtccctttcttccccttagctcttgtggtccttcctctgctgcttccttccctttgtttcccccttctcccctccttcccttatacttcatctccctcctcctagctccctggcctatagaccccatatatagaccagctcccagagaagggaaagggaacttccatttattgaacttctcctatgtgccagacactgtacaaggcgtcttcctcacagcagccctgtgagattgggaagagtggtaacatcccagctgggaccactgtggacaccaacatcacccacccatttgagtttgacttctatctgtgcagccacgcaggcatccag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]