GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-20 09:42:47, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_021939335            2759 bp    mRNA    linear   PRI 20-NOV-2019
DEFINITION  PREDICTED: Papio anubis argonaute RISC catalytic component 3
            (LOC101005189), transcript variant X11, mRNA.
ACCESSION   XM_021939335
VERSION     XM_021939335.1
DBLINK      BioProject: PRJNA576697
KEYWORDS    RefSeq.
SOURCE      Papio anubis (olive baboon)
  ORGANISM  Papio anubis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Cercopithecinae; Papio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044976.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Papio anubis Annotation Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2759
                     /organism="Papio anubis"
                     /mol_type="mRNA"
                     /isolate="15944"
                     /db_xref="taxon:9555"
                     /chromosome="1"
                     /sex="male"
                     /tissue_type="whole blood"
     gene            1..2759
                     /gene="LOC101005189"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 37 ESTs, 10 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 28 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:101005189"
     CDS             163..2043
                     /gene="LOC101005189"
                     /codon_start=1
                     /product="protein argonaute-3 isoform X5"
                     /protein_id="XP_021795027.1"
                     /db_xref="GeneID:101005189"
                     /translation="
MCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYTLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYETDPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
     misc_feature    163..504
                     /gene="LOC101005189"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(298..300,343..345,385..387,397..399,451..453,
                     472..474,478..480)
                     /gene="LOC101005189"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    637..1914
                     /gene="LOC101005189"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1048..1050,1060..1062,1096..1107,1114..1116,
                     1138..1140,1147..1149,1159..1161,1171..1173)
                     /gene="LOC101005189"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1252..1254,1258..1260,1468..1470,1882..1884)
                     /gene="LOC101005189"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
agggaagtgtggtttggattccatcagtctgttcggcctgccatgtggaaaatgatgcttaatattgatgttagaaacgggaaatgtttctaaagtttatttggatggaagtttagcatttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttcttgatattcataatattgatgagcaaccaagacctctgactgattctcatcgggtaaaattcaccaaagagataaaaggtttgaaggttgaagtgactcattgtggaacaatgagacggaaataccgtgtttgtaatgtaacaaggaggcctgccagtcatcaaacctttcctttacagttagaaaatggccaaactgtggagagaacagtagcgcagtatttcagagaaaagtatactcttcagctgaagtacccgcaccttccctgcctgcaagtcgggcaggagcagaaacacacctacctgccgctagaagtctgtaatattgtggcagggcaacgatgtatcaagaagctaacagacaatcagacttccactatgatcaaggcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgaaacggatccatttgttcaggagtttcaatttaaagttcgggatgaaatggctcatgtaactggacgcgtacttccagcacctatgctccagtatggaggacggaatcggacagtagcaacaccaagccacggagtatgggatatgcgagggaagcaattccacacaggagttgaaatcaaaatgtgggctatcgcttgttttgccacacagaggcagtgcagagaagaaatattgaagggtttcacagaccagctgcgtaagatttctaaggatgcagggatgcccatccagggccagccatgcttctgcaaatatgcacagggggcagacagcgtagagcccatgttccggcatctcaagaacacatattctggcctacagcttattatcgtcatcctgccagggaagacaccagtgtatgcggaagtgaaacgtgtaggagacacacttttgggtatggccacacaatgtgttcaagtcaagaatgtaataaaaacatctcctcaaactctctcaaacttgtgcctaaagataaatgttaaactcggaggaatcaataatattcttgtacctcatcaaagaccttctgtgttccagcaaccagtgatctttttgggagccgatgtcactcatccacctgctggtgatggaaagaagccttctattgctgctgttgtaggtagtatggatgcccacccaagcagatactgtgccacagtaagagttcagagaccccgacaggagatcatccaggacttggcctccatggtccgggaacttcttattcaattttataagtcaactcggttcaagcctactcgtatcatcttttatcgggatggtgtttcagaagggcagtttaggcaggtattatattatgaactactagcaattcgagaagcctgcatcagtttggagaaagactatcaacctggaataacctacattgtagttcagaagagacaccacactcgattattttgtgctgataggacagaaagggttggaagaagtggcaatatcccagctggaacaacagttgatacagacattacacacccatatgagtttgatttttacctctgtagccatgctggaatacagggtaccagtcgtccttcacactatcatgttttatgggatgataactgcttcactgcagatgaacttcagctgctaacttaccagctctgccatacttatgtacgctgtacacgatctgtttctatacctgcaccagcgtattacgctcacctggtagcatttagagccagatatcatcttgtggacaaagaacatgacagtgctgaaggaagtcacgtttcaggacagagcaatgggcgagatccacaagctcttgccaaggctgtacagattcaccaagataccttacgcacaatgtactttgcttaaatagtccaagtatattctctgagaggaagcactgaaagatgaactgacatacaacgtatgtttccagtggagtcaattgagtaaggacacctccagccatacagaaaccaacactgtgtgggggccaaggtctgatccttatgttaatacaaggaagattgtttacttcatcaaggaacacagcatcattatgcaatatgaaaccagccaactgctttttgtgcggtctcctgtaggaagtatcgcaattgttttgttttcatttcttgtagtctaacccttttaatgcctttacctcaagttgcttggcagcacaactatctttgcaaaaaaagtatcgaaaaagtaaatgatggtttaaaaaatatacaccttcatgaataatcaaagtgatttttcaaaattatgtgcaaaaaattaatgtgcattcatatattcttgtaaaaggtgtctgtgtgtttttaaaatatatacatccatacttcatatgcatatatatctggatctggattgataatagatatatatgtgtctgtgtatatattttagaattcattccatttggggaacttcctttcccttttattctactagcactaccgcttttatttctctttttcccttgccttcatcacctacattttttccctaatcctaccagtgacattcaaatattcacctacctggttcgtttgaatgtaaaatatggcaaacta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]