GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-02-27 21:02:19, GGRNA.v2 : RefSeq release 98 (Jan, 2020)

LOCUS       XM_021201864            3898 bp    mRNA    linear   ROD 18-JUN-2019
DEFINITION  PREDICTED: Mus pahari NRDE-2, necessary for RNA interference,
            domain containing (Nrde2), transcript variant X2, mRNA.
ACCESSION   XM_021201864
VERSION     XM_021201864.2
DBLINK      BioProject: PRJNA387191
KEYWORDS    RefSeq.
SOURCE      Mus pahari (shrew mouse)
  ORGANISM  Mus pahari
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Coelomys.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_034596.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 18, 2019 this sequence version replaced XM_021201864.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Mus pahari Annotation Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3898
                     /organism="Mus pahari"
                     /mol_type="mRNA"
                     /db_xref="taxon:10093"
                     /chromosome="7"
                     /sex="female"
                     /tissue_type="tail"
     gene            1..3898
                     /gene="Nrde2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 mRNAs, 4 Proteins, and 97%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 2 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:110324358"
     CDS             243..3737
                     /gene="Nrde2"
                     /codon_start=1
                     /product="protein NRDE2 homolog isoform X2"
                     /protein_id="XP_021057523.1"
                     /db_xref="GeneID:110324358"
                     /translation="
MALFPAFADVSEASGDGASRKELDWLSNPSFRVGNLTSLSRQTEEVTALASEGSPPPRSPLKSEPPGESATSEKLTQISRKKKKEKKKKRKHQHPKKSKRRREQSSSSGSESDTEAGKDRASRSIRDGQKEAEKPCQGSNAAAAAAGQRSIWLEDIHDLTDVFRTDNKPDPANWEYKSLYRGDIARYKRKGDSCLGINPKKQCISWEGASATKKHSHRHLERYFTKKNVGLMRMEGIAVCSNPEPPSSEPVTFIPVKDSAEAATPVTSWLNPLGIYDQSTTQWLHGQGPAEQDSKQPDSQQDRECAALKARVEEFNRRVRENPRDTQLWMAFVDFQDEVMRSPGIYALGEGEQEKHRKSLKLLLEKKLAVLERAIESNPGSVELKLAKLQLCSEFWEPSALAKEWQKLLFLHPNNTSLWQRYLSFCQSQFGTFSVSKLHSLYGKCLSTLSAVKDGSMLSHPVLPGTEEAMFGLFLQQCHFLRQAGHSEKVISLFQAMVDFTFFKPDSVKELPTKVQVEFFEPFWDSGEPRVGEKGARGWRAWMHQQERGGWVLVTPDEDDEEPEEEDQEIKDKTLPRWQIWLAAERSRDQRHWRPWRPDKTKKQTEEDCEDPERQVLFDDIGQSLIRLSSPGLQFQLIEAFLQFLGVPSGFLPPASCLYLAMDESSIFENELYDEKPLTYFNPSFSGISCVGYMEQLGCPRWTKGHNREGEEFVRNVFHLVLPLFSGKQKSQLCLSWLRYEIAKVIWCLHTKKKRLKSQGKNCKKLAKNLLKEPENRNNFCLWKQYAHLEWLLGNTEDARKVFDTALSMAGSSELKDRELCELSLLYAELEMELSPDLRGATTGRAVHILTRLTESSPYGAYTGQVSSTQILKARKAYEHALQDCLGQGCASSPAPAEALDCLGSLVRCFMLFQYLTVGIDAAVQIYGQVFSKLKGSALLEGPGSEDSTSSQSLTSVLEAVTMMHTSLLRFHMNVCVYPLAPLRETLSDALKLYPGNQVLWRAYVQIQNKSHSANKTRRFFDTVTRSAKHLEPWLFAIEAEKLRKRLVESVQRVGGREVHATIPETGLTHRIRALFENAIRSDKGNQCPLLWRMYLNFLVSLGNKERSKGVFYKALQSCPWAKVLYMDAMEYFPDELQEILDVMTEKELRVRLPLEELELLLED"
     misc_feature    1182..2000
                     /gene="Nrde2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:312057"
ORIGIN      
ccagcgttcagtgaagccggagggcactaactacaaggaaacagttcttcctcgttctcatcctttcccctcctcccctctctaccctttgggtctccgcaccgccttgcccaggggttaagcctcgacgagtgcaggaagaactacatttcccagagtgcctcgcgaattcagcgtcctccaaccagagctctccagacggcgccatttctgtggcaggagtggtggtgcggcctgtgatcatggcgctgttcccggcctttgcggacgtaagtgaggcctccggtgatggggcatccaggaaagagttagattggctgagcaacccaagctttcgtgttggaaatctaacttctctgagccgacaaactgaagaggtcacagcccttgcttctgaagggtcaccaccgccaaggagtcctctgaagtcagagcccccaggggagagcgccactagtgagaagctcacacagatcagcaggaagaagaagaaggagaaaaagaagaaaaggaagcaccagcaccccaagaaaagcaagaggaggcgtgagcagtcgagcagcagtggctctgagtcggacacagaggctgggaaggacagggcttcccgaagcatcagggatggccagaaggaagctgagaaaccctgtcagggaagcaatgctgctgctgctgctgctggacagcgttccatttggctggaagatattcacgatctgaccgatgtcttcaggacagataacaaaccagatcctgccaactgggagtataaatctctgtatcgtggggacatagcaaggtacaagagaaagggagactcctgccttggtatcaatcctaagaaacagtgtatatcttgggaaggggcttctgcaacaaagaagcactcacacaggcacctggagcgctattttaccaagaagaatgtggggttaatgagaatggagggcattgctgtgtgtagtaaccccgagcctccctcctccgagccagtcacattcatcccagtgaaggactctgctgaggcggctactcctgttacatcatggctgaatcccctggggatttatgatcagtctaccacacagtggttacacggacagggtccagcagagcaagactcaaagcagccagactcacaacaggacagggagtgtgctgctctcaaggctagagtggaagagtttaacagaagggttcgggagaatcctcgggacacgcagctatggatggcgtttgtggatttccaggacgaggtcatgaggagtcctggcatctatgcccttggggaaggagaacaggagaagcacaggaagtccctgaagctcctcctggagaagaagctggctgtgctggagcgggccatcgagagcaacccaggcagcgtggagctgaagctcgccaagctgcagctgtgctcagagttctgggagcctagcgcgctggccaaggagtggcagaagctcctcttcctgcaccccaacaacacaagcctgtggcagcgctatctctccttttgccagagccagtttggtaccttttctgtgtccaaactccacagtctgtatggcaagtgcttgagtaccttgtctgctgttaaagatggcagcatgctatcccaccctgtgttgccgggcactgaggaggccatgtttgggctctttcttcagcagtgccattttctacggcaggctggccactcagagaaggtcatctctttgttccaggccatggttgacttcaccttcttcaagcctgacagtgtgaaagagctgcctactaaagtacaggtggagttctttgagcccttctgggacagcggagagccacgtgttggggagaagggagcccgaggctggcgggcatggatgcaccaacaggagcgcggtggctgggtgcttgtcaccccagatgaggatgacgaggagccagaagaggaagaccaggagataaaagacaagaccctgcccaggtggcagatctggctcgctgctgaacgttctcgagaccagaggcactggcgtccctggcgccctgataagaccaagaagcaaacagaggaagactgtgaggaccctgagagacaggtgctgtttgatgatattgggcaatctttgatcagactttccagcccaggtcttcagttccagctcattgaggcctttctgcagttcttgggcgtgccttctggcttccttcccccagcctcctgcctttatctggccatggatgagagcagcatctttgagaatgaactttatgatgaaaagcccttgacttacttcaacccttccttttcgggcattagctgtgttggctacatggaacagttgggttgccctcgctggaccaaaggtcacaaccgagagggtgaggagtttgtccgcaatgtcttccacctggtgctgcctttgttctcaggcaagcagaagtcccagctctgcctctcctggttacggtacgagattgcaaaggtcatttggtgtctacacactaaaaagaagcgattaaagtctcagggaaagaactgcaaaaaactagccaagaatctccttaaggagccagaaaaccgcaacaacttctgcctctggaagcagtatgcgcacctggaatggttgctgggtaacacagaggatgccagaaaagtgttcgacacagcgctcagcatggccggcagcagcgagctgaaggaccgtgaactctgcgaactcagtctgctctatgctgagctggagatggaactgtcgccggacttgagaggagccaccacaggccgagcggtccacatattaacacggctgacggagagcagtccctacggggcctacactgggcaggtctcgtccacccagattctgaaagctcggaaggcttacgagcacgcgctgcaggactgcctgggccagggctgtgcctccagcccagctcctgccgaggccttggactgcctgggtagcttggtccgatgctttatgctcttccagtatttgactgtgggcattgatgctgctgtgcagatatatggacaggtcttttccaagctgaagggctctgctctcctagaaggccctgggtcagaggacagcaccagctcccagagtttgaccagtgtccttgaggctgtcaccatgatgcacacaagcctgctgcgattccacatgaatgtttgtgtgtaccctctggctccactccgagagaccctctcagatgctttaaagctgtatccgggcaaccaggttctttggagggcttacgtacagattcagaataagtcccacagtgctaacaagaccagaaggttctttgacacagtcactaggtctgccaaacatttggagccttggctgtttgcaattgaagctgagaagctgaggaaaaggctggtggaatctgttcagagggttggcggcagggaggtccatgcaaccatccctgagactggccttacgcatcggatcagagctttgtttgaaaatgcgattcggagcgacaagggcaaccagtgccccctactatggaggatgtatctgaattttttggtttccttaggaaacaaagaaagaagcaaaggcgtgttctacaaggccctccagagctgtccttgggcaaaggtgctatacatggacgccatggagtatttcccagatgagctgcaggagatcctggacgtgatgaccgagaaggagctccgtgtgcgcctgccccttgaggagctggagctattgctggaggattagcgtgcagccaggcctgtgtcagcctgcagagcccagagctgcagctgtgcagggacttgctccactgtcctggtggggattggatgtattgatttacatattatatatgtgatctatatgtacaaactgagtcgtgccagtgataaaccttttgtggttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]