GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:18:46, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_020501407            4053 bp    mRNA    linear   VRT 09-DEC-2019
DEFINITION  PREDICTED: Oncorhynchus kisutch NRDE-2, necessary for RNA
            interference, domain containing (nrde2), transcript variant X2,
            mRNA.
ACCESSION   XM_020501407
VERSION     XM_020501407.2
DBLINK      BioProject: PRJNA378663
KEYWORDS    RefSeq.
SOURCE      Oncorhynchus kisutch (coho salmon)
  ORGANISM  Oncorhynchus kisutch
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Protacanthopterygii;
            Salmoniformes; Salmonidae; Salmoninae; Oncorhynchus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_034187.2) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Dec 9, 2019 this sequence version replaced XM_020501407.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Oncorhynchus kisutch Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4053
                     /organism="Oncorhynchus kisutch"
                     /mol_type="mRNA"
                     /isolate="150728-3"
                     /db_xref="taxon:8019"
                     /sex="female"
                     /tissue_type="muscle"
                     /dev_stage="juvenile"
                     /country="Canada: Vancouver"
                     /linkage_group="LG14"
                     /note="double haploid"
     gene            1..4053
                     /gene="nrde2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 24 long SRA reads, 3 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 18 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:109904200"
     CDS             132..3713
                     /gene="nrde2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2 isoform X1"
                     /protein_id="XP_020356996.1"
                     /db_xref="GeneID:109904200"
                     /translation="
MTSHSCDCLHAEAINMALFPAFAGLSNTKAEIAPKELEWLSNQSFRTDDALSLHQRATEKANETQSAETSRHVIPEREDKNDVQSNKKKKKEKKKKKKKKKKHKKKSGEPSPASSGSDSDTIYPSDLLKKAESTPPSEKFQVEGSFVWLDDLQTPTDQPFCVDRRADRANWEYKSLYRGDIARYKRKGSSSLGLNLRSQAVSWAESGPEKKRVDRRQRPNRYFSPTVRQLLMSDGKPTLPRPPPEDTTTTTLPFIPVPSCLEGEAEGGGSAKGQGSWVNPLGVYDSSTSLWLQGKGKAEHGKAEEQPSTPRDNAAVMLAERVEDFNRRLRETPTDTHTWLQFVLFQDEVAGAPGVFADISENESERRKRSVRATLEKKVAILDRAVENNPSCVELKLERLRLCRELWEPAALLKEWKKLVFLHPNSAPLWRKYLLFMQSHFSTFSVSKVNTVYGKCLSTLAAVQDGSMVSHQMLPGTDEHMLAIFLQQCHFLRQAGHSEKAVCLFQGLLDFTFFKPDTVKDLPTRQQVEFFEPFWDSGEPRVGERGASGWRAWMTQQERGGWLQPSEQDDGDEEDQEELEVKDKTWPKWRIWLDVETSREAIHWLPWRPDKTKGQSVEDCEDPDRQVLFDDIGPSMIRLVHPDLQLCLLLSFLHFLGLPADTSCYSTPSCSLLLDDQALLGDVHHPDSPLTSYALPVPGVSPVGHMTSLQGARRGVGLCKPGEEFVDNMFQMVLPLFSAQERAVLSLHWIQYEKLKVLRCVRGRNKKRVKSQGKRSKRLAKRLLKEPENRGRLSLWREYAHLEWLLGNLDEAHKVFDTALGLGVAGGLADPALCDLCLLYAQLEVEEAWRRDTGGAGTTVTTAMSSPAVYILTKLAEGSSYAPFLGQLAPVAVLKARKAYEQAVVSSLPGQEEGAAGQGQSKSRQVKGLVGCYALFQYLTVGVDAADAVYNLARKRLEQHSSMSAQESASSEVMCDIQTLSSVSECEALAVQQVALLRYHTSTNVYPLSHIRLALTSALAHFASSTSLWQLYVQVENRYHSAGRARRFFHSVTKASASVVPRLFAISAEQQRKQLVDSVQRSDCYGDTVSSLPENGLSNRIRSLFENAIATEHGVHCPLLWRMYMNFLVSEGKVEKGRGIFYKALQDVPWAKGLYMDAVQLFPEHVQEFLDLMTEKELRLRVPMEEVDILLED"
     misc_feature    1101..1817
                     /gene="nrde2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:312057"
ORIGIN      
attggatacagtggacctgcaatattctgcccaatgtacgggagcccacgattggctacgttggatctgcaatgcgtcaaacaatggcgcctaatattacctgagtagtttaggaaaacggcgcgttcgagatgacgtcacattcatgcgactgtttacacgcagaggctatcaacatggccctatttccagcttttgcaggattatcaaatacaaaagctgagattgcacctaaagaactagaatggctgagcaatcaaagtttccgcactgatgacgctctctctcttcaccaacgagccactgagaaagccaacgaaacacaatcggcagaaacaagcagacacgttataccagagagggaggataagaatgatgtccaatccaacaagaagaaaaagaaggagaagaagaagaagaagaagaaaaagaagaagcacaagaagaagagtggagaaccctctccagcaagcagtggctcagattcggatactatctaccccagtgacctcctaaaaaaggctgagagcactcctcccagtgagaagtttcaggtggaggggtcttttgtgtggttggatgacctacagacccccaccgatcagcccttctgcgtggacaggagagcagaccgtgccaactgggagtacaaatcactttacagaggagatatcgctaggtacaaaaggaaaggctcttcctctctgggtttgaacctgcggtctcaggccgtgagctgggctgagtctggcccagagaagaagagagtggacaggagacagagacccaaccgctacttctcccccaccgtccgccagctgctgatgtctgatggcaaacccacgctgcccagacctccaccagaggacaccacaaccaccaccttacccttcatccctgtgccctcctgtctggaaggtgaggcagaggggggtggctctgccaaaggccagggctcctgggtcaaccccctgggggtgtatgactcctccacgtccctgtggctccaggggaaggggaaggcggagcatggcaaggcagaggaacaaccttctactcccagggacaatgctgccgtcatgctggctgaacgggtggaggacttcaataggaggctgagggaaacccccacagacacacacacctggcttcagtttgtcctcttccaggacgaggtagctggggcgcctggggtgtttgctgacatctctgagaacgagagcgagcggcggaagaggtcagtgcgggccacgctggagaagaaggtagccattttggatcgagcagtggagaataacccgagctgcgtggaactgaagctggagcgactgcggctctgtagggagctgtgggagccggcagccctgctgaaggagtggaaaaagctggtgttcctgcaccccaacagcgcccccctgtggaggaagtacctgctgttcatgcagagccacttcagtaccttctccgtgtcaaaggtcaacacggtatacgggaagtgtctgagcacgctggcggcggtgcaggatgggagcatggtttctcaccagatgctgccgggcactgatgaacacatgctggccatcttcctccagcagtgtcatttcctcaggcaggctggtcactcagagaaagctgtgtgtctgttccagggcctactggacttcaccttcttcaagccagacactgtcaaggacctacccaccagacaacaggtggagttctttgagccattctgggacagtggggagccccgtgtcggggagagaggggccagtggatggagagcctggatgacccagcaggagagagggggctggctccaacccagtgaacaagatgatggagatgaagaagatcaggaggaattggaggtgaaggataaaacctggcccaagtggaggatctggttggatgtggagacgtcacgcgaggccatccattggctgccatggaggccggacaaaaccaagggccaatcggtggaggactgtgaggacccggaccgacaggtgctgtttgatgacattgggccgtctatgatccggctggtccacccagacctccagctatgtcttcttctgtccttcctgcacttcctgggtctgcctgctgacacttcctgttacagcaccccctcctgtagcctgctgctggatgaccaggctctactgggggatgttcaccaccctgactcaccactgacctcttatgccctccctgttcctggggtcagccccgtgggtcacatgacctccctgcagggtgccaggaggggggtggggctgtgtaagccaggggaggagtttgtagacaacatgttccagatggttctgcctctgttctctgctcaggagagagctgtcctctcactacactggatccagtatgagaagctcaaggtgctgaggtgcgtgcgcggcaggaacaagaagcgtgtgaaatcccaggggaagaggagcaagcgcctggccaagcgcctgctgaaggagccagagaaccggggccgcctcagcctgtggagggagtacgcccacctggagtggctgctagggaatttggacgaggcccacaaggtgttcgacacagccctgggactgggcgtggcaggagggctggcagaccctgccctgtgtgacctctgcctgctctacgcccagctggaggtggaggaggcctggcgaagggatacgggcggggcagggacgactgttacgaccgccatgtcttcaccagcggtctatatcctcaccaagctagcagagggtagttcgtatgcccccttcttgggacagttggctccagtggctgtgctgaaggccaggaaggcctatgagcaggctgtggtgagctccctgcctgggcaggaggagggggccgcggggcaggggcaatccaagtccaggcaggtcaaaggtctggtggggtgttacgccctattccagtacctgactgtgggggttgatgctgctgatgctgtctacaacctggccaggaagaggctggagcaacactccagtatgtcagcccaggagtcagctagcagtgaagttatgtgtgacatacagacactgagctctgtctcagagtgtgaggccctggctgtccagcaggtggcgctgctgcgctaccacaccagcaccaacgtgtacccacttagccatatcagactggcgctgacctcggccctggcccactttgcctccagcacttctctgtggcagttgtatgtgcaggtggagaaccgctaccatagcgctggcagggctcgccgcttcttccacagcgtgaccaaggctagtgccagtgtcgtgccacgcctgttcgccatcagcgcagagcagcaaaggaagcaactagtggactctgttcagaggtctgattgctatggtgacaccgtctccagcctgccagagaacggcctgagcaaccgtatccgctcgctgtttgagaatgccatagcaacagagcacggggtccactgtccgttgctgtggaggatgtacatgaacttcctggtgtcagaggggaaggtggaaaagggaagaggtatcttctacaaggctctacaggacgtcccatgggcaaagggtttatacatggacgctgtgcaactcttccctgagcacgtgcaggagttcctggacctgatgaccgagaaggagctcagactgagggttcccatggaggaggtggacatactgctggaagactgaggctctaaaacccttcccacagtgcactgtggcctggcttcctcagacactccactgtggatacccgaagttgtgcactgaccaatagaacaaccaagtgtcctcatgaagaagaccattttacttttcaaacagacgtgtgaataaatgatgttacacttattagtgttaattcaatattttgatggattgcaaatccatatttttatatttccagctttttatggattcttaatccatattttgattaacataatatcctatttttctgtcaaagatttgtttagattagtttttttgtgtgttttttatggactgaaataaatgttttgtttcctaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]