GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-12-05 23:51:13, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XM_020044716            7389 bp    mRNA    linear   VRT 11-MAY-2020
DEFINITION  PREDICTED: Esox lucius argonaute RISC catalytic component 3b
            (ago3b), transcript variant X3, mRNA.
ACCESSION   XM_020044716
VERSION     XM_020044716.3
DBLINK      BioProject: PRJNA629749
KEYWORDS    RefSeq.
SOURCE      Esox lucius (northern pike)
  ORGANISM  Esox lucius
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Protacanthopterygii;
            Esociformes; Esocidae; Esox.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_047578.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On May 11, 2020 this sequence version replaced XM_020044716.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Esox lucius Annotation Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..7389
                     /organism="Esox lucius"
                     /mol_type="mRNA"
                     /isolate="fEsoLuc1"
                     /db_xref="taxon:8010"
                     /chromosome="10"
                     /tissue_type="liver, spleen"
                     /dev_stage="adult"
                     /country="Czech Republic: Jihlava River, Danube basin"
                     /lat_lon="49.218 N 16.717 E"
                     /collection_date="29-Nov-2018"
                     /collected_by="Martin Reichard"
     gene            1..7389
                     /gene="ago3b"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 6 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:105007758"
     CDS             298..2727
                     /gene="ago3b"
                     /codon_start=1
                     /product="protein argonaute-3 isoform X3"
                     /protein_id="XP_019900275.1"
                     /db_xref="GeneID:105007758"
                     /translation="
MVKHFKVTIFGDRRPVYDGKRSLYTANPLPVATAGVDLDVTLPGEGGKDRPFKVSIKFVSLVSWHMLHEVLTGHAMPEPLELDKPISTNPVHAVDVVLRHLPSMKYTPVGRSFFSSPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYSLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVPGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYEADPFVQEFQFRVRDEMAQVTGRVLPAPLLQYGGRASSEHFMPQQMNPAVSLQNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEVIQDLASMVRELLIQFYKSTRYKPTRIIFYRDGVSEGQFRQVLYYELLAIREACIMLEKEYQPGITYIVVQKRHHTRLFCADRNERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADEFQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHISGQSNGRDPTALAKAVQIHHDTMRTMYFA"
     misc_feature    307..591
                     /gene="ago3b"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:318646"
     misc_feature    619..771
                     /gene="ago3b"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:312283"
     misc_feature    772..1134
                     /gene="ago3b"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(928..930,973..975,1015..1017,1027..1029,1081..1083,
                     1102..1104,1108..1110)
                     /gene="ago3b"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1267..2598
                     /gene="ago3b"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1732..1734,1744..1746,1780..1791,1798..1800,
                     1822..1824,1831..1833,1843..1845,1855..1857)
                     /gene="ago3b"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(1936..1938,1942..1944,2152..2154,2566..2568)
                     /gene="ago3b"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
tctacacagggcagacccacacaagccagcagagacaccaaaggcccatcctatggtaaaagagggtgagattggcccctccacttcccctcactctccggcaaagggaaaaggaggctaacgagtaggagaaaggagttaggagtttcactgggctggggaaaagtcacataatccaagtgctgaatggataaattgctgaggatgtaatccagatggtagcagggcaacagaccaaaaggcagcatatggcaggagggttccaaagaagatgactagcaggaggtggttgactccatggtgaagcacttcaaagtaaccatatttggggaccgaaggccagtctacgatgggaaaagaagcctctacacagctaacccactaccagtagccacagcaggggtggatttagatgtcaccctaccaggggaggggggtaaagatcgtcccttcaaagtgtccatcaagtttgtgtcgctagtcagctggcacatgctgcacgaagtcctgactggacatgccatgcctgagcccttggagctggacaaacctatcagcaccaaccctgtacatgctgtggatgtggtgctgcgacacctgccctccatgaagtacacaccagtggggcgctctttcttctcatccccagagggttatgaccaccctctgggtgggggaagggaggtctggttcggcttccaccagtcagtgcggccagccatgtggaagatgatgctcaacattgatgtatcggccacggcattctacaaggcccagcccgtgatccagttcatgtgtgaggtcctggatatccacaacatagacgaacagccccgccccctcaccgactctcacagggtcaagttcaccaaagagatcaaaggtctgaaggtggaagtgacccactgtggtacaatgcggagaaagtacagagtgtgtaacgtgacccgccgccctgccagccaccagacgtttcctcttcagctggagaatggtcagacagtggagcgcacagtggcccagtacttcagagagaaatacagcctacagctgaagtaccctcacctcccctgtctacaggtgggccaggagcagaaacacacctacctgccactggaagtttgcaacatagttcctggccaacgctgtattaaaaaactcactgataaccagacgtcgaccatgatcaaagccacggcccgctctgccccagacagacaggaggagattagcaggctggtgcggagtgcaaactatgaggcagacccatttgtgcaggagttccagttccgggtgcgtgacgagatggcccaggtgacgggtcgtgtgctgccagccccattgcttcagtacggcggcagagcgagttctgaacacttcatgccacagcagatgaaccctgcagtgtctttgcagaaccgcactgtggccactcccagccatggagtgtgggacatgaggggcaaacagttccacaccggtgttgagattaaaatgtgggccatcgcctgcttcgccactcagaggcagtgtcgtgaggagatcctcaagggtttcaccgaccagctgcggaagatctctaaggatgctgggatgcccatccagggccagccatgtttctgtaagtacgcccagggagcggacagtgtggagcccatgttcaggcacttgaagaacacctatgctggactgcagctcatcatcgtcatcctgcctggaaagacgcctgtctacgctgaggtaaagcgggtaggagacaccctcctgggcatggccactcagtgtgtccaggtgaagaacgtggtgaagacgtccccccagaccctctccaacctctgcctcaagatcaatgtcaagctggggggcatcaacaatatcctggtgccacaccaacgtccctcagtattccaacagcctgttatcttcctgggggctgacgtcactcaccctccagccggtgatggaaagaagccatccattgcggcggtggtgggcagtatggatgcccaccccagcaggtactgtgctactgtaagggtccagaggcccagacaggaagtgatccaggacctggcctccatggtgcgagagctgctcatccagttctacaagtccacccgttacaaacctaccagaatcatcttctacagggatggcgtgtcagagggacagttcagacaggtgctgtactatgaactgttagccattagggaagcctgtatcatgctggagaaggagtatcagccaggcatcacctatattgtggtgcagaagaggcaccacacacgccttttctgtgcagaccgcaacgaacgtgtgggacgtagtggtaacatccctgcaggcaccaccgtggacacagacatcacccacccctacgagtttgacttttacctctgcagccacgcgggaatacagggtacaagccggccttctcactaccatgtcctttgggacgacaactgcttcactgccgacgagttccagcttctcacctaccagctgtgccacacctacgtccgctgcacccgctccgtctccatccctgcaccagcctactatgcccacttggtggcttttcgcgcccgctaccatctggtggacaaagaacatgacagtgcggagggtagccacatctcggggcagagcaacggcagagatcccacagcccttgccaaggctgttcagattcaccatgacacaatgaggaccatgtactttgcctaacagcttgaacacccctctcaaccaaccaccaacatcgtatcaccccctagtggggttcagcctggtctgtctcacatctgaccctgggccggtacagctctggtcccaccaagaggacgccaagctgctaagttcaaaaacaacaacaaaaacagccagagggcagcacagcaaggttatgcaatacaaaaccagccaatggtctccagccccgttctcctctgcagtgtttctttttttttattcgttgttaatgatctgaaacgtggttgacaagctgcactggtcacgtccttgtcgaacaggtttattttggacagcatctcaactttcactttgtgttacttgcaacgtggcaacacgtggaaatggaagcgaggaatcgattgaggaaagctttagtgggcaggtgggtggtttgacagtgccgttgttggtccagaggggaccgttttagttttttcaacctattgatgatctgatgatctcgttgcatgtctcagtcaacctgtagccgttatcttgtgagtctttgcatgttctgtagacgtctgatcgccatggcgatgcccatcatttgagaatgcttgtctatcacagatgtgacctgttttcctacgacaagttggtcatctagttaatatgctctcttctttagccaatggtgacttatttgcattcattgcgccagagtttaacattgcactctatatatcaatctcagcattgataaaaaatttttttacatacagccacaaacagccattgttttaaagattatctgagaagtgctgttagaatatcaacactggctacttcatgaacctacttggaacctttcagagttcactgtagcatttcccttttgctttcagttttactacacgttgctttttatgagatcggccttatttaaaatctgttttcagttatcactgtttgtttgttttgtctttttttaagtaaggaactgacagtgtcatggaatcttttagtgcaataagtgtctaaagcaaaagatgggttctatggttaatataacaatttggggcagttgtgatcagaatagaacaggggacaaaagatacagaatgttggtgaactggagtggattgattccacagcaataacttacattgtgagttaattcgagcaattgatattattacaaaaaaggagtttattaaatggggtgaataatgaatgaatgaataagtgcctgttttgggtgggaaatagaagaacttgaaagccaacggatgtatttattttagttggagctcctctgaggtccattagttaggttacagtacagtgaaatagtgtaatccaggcattactgtaagcatgatatattgaccaaaatggtctggcatttgagagctgtgtgtgtgtgtgtgtggcagcatgaattcagtttcatgattaagttttcaatgtgaattattacatcatcgaataacgtatattgaccaattgaaggttggggacaggtttagctattgaatctgtctcattcattttaatgctctggagataggactcatttttgcactgttaaaattaaaccttcgtatttggggatatgaaaaggtgatttgtcacattgtatcaaagggcattttctatcccatagccttgctgtgcagcatcctcggggtgtcagggacggttttcgacttttgtctagttccactctgaccaaatcatcgtgcctcgttgtgtgaggaggagtgttcggggcatgcacagtttggccacgtccagctacagctgatcctggctcacactgcaattgcaaaagaagtggttgcagcgtggccggtgctataccacgcttgtcctatagccacgtgttaccagaaccaaactagctgctataacacgtgttttcattcatatatattcatacaatgtgcaaaaagagactataagtatacaacaatttactgcacttacagatgcttgtgtttcaggtgagacaggtggcctggtgctgagcggcagtgtgtgtgtgcatgtgtgcgtgcgctgtattcaaatattttaatcttaatttggtgtaacatagaggaatcccccgtgctatgatacgaggagacatacccatagttctactaagaaagtggtggaaatctatagagctagaccctggaggtggtatgaattaactcccaacaaatgtttgtacttttcttcaaggcatcaggcacagccatttgattttacttgaagagcaaatataggtgggtaggatccagtcaactgcaactgtgggctaatgtgtagccacctcactattttgagcaacatttgaagtccttacagtcgtagtacaaataggaattctctctacacttgcgtcgcaacagaataaaccttcagagcctagtgactggggttggatctagcaggagctgtattgggagctgattggtgggggtcctaatgcagtgtctgagttgcaaatggtaccctttccctttatagtgcagaactaacaaaagtagtgctctaagtagagaatagggtgccatatgttacttaaccaggttcctctaagtgatgccctcaactctataaaagctggacatcagatgccttctttaatgttattttaaagcatttctaattatgaaacatagatatttgtatatgtaataatattaaagaccacttatttttgctaacaaattctaagaaacattaaattatatgaatcagtaaaacaattattaatagtaaaataaagaatacaatagtaatactaataataatatacatgtaataatgctattgtttatatgttgtgtgaaagaaaagctactgagatctgttgcattgaatttacctttgtgtggggaagtgctgtttttttcgttggcagatgttgtgttgttgtgtagtaactgattagataaacctccctctattccctgtcaccctgttctctgttcattaaactaacatgctttggagagtggcctagcttcctttcagtagcatccattaaactcacagaaactggtcttgtagaacatgtagtgaatgtgacctcaattttgagtgttaacttcatccaagacagttggtgtgtatgtttgtgtttgtgcacattttactatcctggtggggaccaaaaatactcgcagggataacaaacaaggaaacaaggaacattttaccttgagaaaacattatgcctgttcctataatggatttgggtagcatttacatttgggttatgtttagtactatggctaagtttttgggtttacgagatgttgagcagagaacagaatttttaatgggaataattttttatgtccccacaaggatagagatttaaaaaatgtgtgtgcgtatcattgttttttaatgttgtggggtggggttgaaggttcatccatggacagaattgtctctagactgtgcctttcatgatggtgctgaaaacgaataaatcaaagaagatatcttactttcaaaacattgatggcaatatgcccatttcaatatggaagtgtgtgttgacagtcgacaatactgtaaaacatgctcgtttgtgtgtatgtgtgtgccttgggtgtatgtttgtctgtacctctgatatgccaagaaatacatcaaaatgcagaagtgatccattttgaagtgtcaggaccaaaaaggcttgtggaaatggtaaagtggtcatgcagtcacatggctcaacaaccaaaatgtgtatttttactaactgggcactgaaatggaaatttcaaactgccaccatcttatgttggaaaccagttaagtgtaatgtatgagatttttgcctttgatttcatttgttatatcctttaattgatgtcaagcaataggggtgttctccccaatgtgccagcaataaacaaagtgatttttatcctctgagcaactgaatgttgggttacatcagagtaatttcccaaattaaactattgcctatacggcactacttttgactagtggtgcactatgaataacatagggtgttatttgggaattaactttcaaagtacacgttttaattaccatcccatgtgagcgccttgcattctatttgccaccttttggatgctaattgttctcaaattaattatatgtctcaaatggcactgtattccctatatgacgcactctctttgaacagtgctcgtggggctctgttcaaaaatagtgcaaattgttggtattatggtgtcacttggtacagaactactgttgtaggcctatgcatatgtgtgtcctattttttcagaaaatactgctctggcgtatacagaatgtatatgtttctcctcaagatctttatggaaatacctcagcgtgttgcatctggaagttaaaacaaaatgcagttatccagttgtgccacatgagtgcccacttgcctgggaaaagattcctcagacagttcctccaaaccctgcgcctctaatgtggtttgctgtatatcagacttaataaggtacaaatgatcaattgctttggtacaagtataatgcacagttttctgttttttttccctgataatgaaattgttgtgacacttttagaagtataattgtatgtacagaaaataccttttgtcttaacacttatctgatcccagtcctaagttgaatccttatatttcat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]