ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-07-18 00:12:11, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_018225529 1350 bp mRNA linear VRT 14-MAY-2021 DEFINITION PREDICTED: Xenopus laevis pituitary homeobox 3-like [provisional] L homeolog (homeobox100496651-provisional.L), mRNA. ACCESSION XM_018225529 VERSION XM_018225529.2 DBLINK BioProject: PRJNA338693 KEYWORDS RefSeq. SOURCE Xenopus laevis (African clawed frog) ORGANISM Xenopus laevis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae; Xenopus; Xenopus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_054383.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On May 14, 2021 this sequence version replaced XM_018225529.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Xenopus laevis Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.6 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1350 /organism="Xenopus laevis" /mol_type="mRNA" /strain="J_2021" /db_xref="taxon:8355" /chromosome="7L" /sex="female" /tissue_type="Erythrocytes" /dev_stage="adult" /collection_date="06-Jul-2016" /collected_by="Jessica Lyons" gene 1..1350 /gene="homeobox100496651-provisional.L" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 15 samples with support for all annotated introns" /db_xref="GeneID:108696287" /db_xref="Xenbase:XB-GENE-22065714" CDS 68..829 /gene="homeobox100496651-provisional.L" /codon_start=1 /product="pituitary homeobox 3" /protein_id="XP_018081018.1" /db_xref="GeneID:108696287" /db_xref="Xenbase:XB-GENE-22065714" /translation="
MHAEREKIQDKDTQERGSSNHFHGKTRRRRTVYSQAHLDLLLSTFDTDPYPGIAVRERLSQLTGVHESRIQVWFQNRRARKKSVHERENVQNTNEWQQYNHISKTNKSSQAEWISKNNGHYKNQEFGFGNRSVNSYPYTNSSKSSALRFPLPFQWPKPMQASFNHLASVYPPRISDSRTQQHQVFIRQISTSHLTPAISILHSKDCVSQPESVSYGTMQEWSLEQMLEEFQPCWTNVADNFIDNINKVCHSVH"
misc_feature 143..313
/gene="homeobox100496651-provisional.L"
/note="Homeodomain; Region: HOX; smart00389"
/db_xref="CDD:197696"
misc_feature order(146..160,164..166,215..217,233..235,272..274,
278..283,290..295,299..307,311..313)
/gene="homeobox100496651-provisional.L"
/note="DNA binding site [nucleotide binding]"
/db_xref="CDD:238039"
misc_feature order(152..154,161..163,281..283,290..295,302..304)
/gene="homeobox100496651-provisional.L"
/note="specific DNA base contacts [nucleotide binding];
other site"
/db_xref="CDD:238039"
ORIGIN
acatgccagttgtgaaaagttactactggagagtatcaacacaaaaagcttagagaagaagctggagatgcatgcagaaagagagaaaatccaagacaaagacacccaagaaagaggtagctccaaccactttcatgggaaaacaagaaggagacgaactgtatacagccaagcccaccttgatctcctgcttagcacatttgatacagacccatatcctggaatcgcagtgagagaaagactgtcacaactaactggtgtacatgaatcaagaatacaggtctggttccaaaatagaagagccaggaagaaaagtgtgcacgaaagagagaatgtacaaaacacaaatgaatggcaacaatacaatcatatttctaaaactaacaagtcatcacaggctgaatggatttccaaaaacaatggacattataaaaaccaggaattcggatttggaaatcgctctgttaactcgtacccttataccaattcttccaaatccagtgcgctgagatttccccttccatttcagtggccaaaaccaatgcaggcatcattcaaccatctggcctcggtatacccaccaagaatatctgatagcagaacacagcaacatcaagtgtttatcaggcaaatatctaccagccaccttacacctgctatcagtattctccattctaaagattgtgttagtcaaccagagtctgtttcttatggcacaatgcaagaatggtccttggaacagatgttggaagaattccagccttgttggacaaatgtggcagataattttattgataatataaacaaagtctgccattcagtgcattaaggaagagggcagttataattttttaccaagagcttattctaacaatgttagttttagtacaattacagaagttgtgtaatattagcacaaacatttctgcaggtttaatcagctgtagcatttactgttacctgtttaaatacaaacatattgttagttgttatgggttactgcacctgtgcaaactttgtgacttttattatatatgggggatatgtgttttataactcatgttgaaaagggccagagatcattgtgggaaaaaggatgactgtaattactataaaggactgagcaaactgcaagtgtgattgtttagtaactgcaatggattgcaaatgtgtttaatgaaaccctttgaaatcctattacttgcaccaaaacacggcagtctataaagcaagtacatcatctaacaataatcagtctcattttactacatatctgtagttctgaccatatgtgatgctgcagaatattgtgtattttataaataaagatatttttacattaatttcttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]