GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-23 23:02:57, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_017558171            1998 bp    mRNA    linear   PLN 28-DEC-2022
DEFINITION  PREDICTED: Vigna angularis protein NETWORKED 4B (LOC108325156),
            transcript variant X1, mRNA.
ACCESSION   XM_017558171
VERSION     XM_017558171.2
DBLINK      BioProject: PRJNA911773
KEYWORDS    RefSeq.
SOURCE      Vigna angularis (adzuki bean)
  ORGANISM  Vigna angularis
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50
            kb inversion clade; NPAAA clade; indigoferoid/millettioid clade;
            Phaseoleae; Vigna.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_068972) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Dec 28, 2022 this sequence version replaced XM_017558171.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_016808095.1-RS_2022_12
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1998
                     /organism="Vigna angularis"
                     /mol_type="mRNA"
                     /cultivar="LongXiaoDou No.4"
                     /db_xref="taxon:3914"
                     /chromosome="3"
                     /tissue_type="leaf"
                     /dev_stage="squaring stage"
                     /country="China: Harbin, Heilongjiang"
     gene            1..1998
                     /gene="LOC108325156"
                     /note="protein NETWORKED 4B; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 5 long
                     SRA reads, 1 Protein"
                     /db_xref="GeneID:108325156"
     CDS             135..1826
                     /gene="LOC108325156"
                     /codon_start=1
                     /product="protein NETWORKED 4B"
                     /protein_id="XP_017413660.1"
                     /db_xref="GeneID:108325156"
                     /translation="
MMKNQPSQWWWLESHSNTRRSPWLQSTLTELNEKTKAMLKLIEEDADSFAQRAEMYYKKRPQLVSMVEDFYRTHRSLAERYDQIAGIRQQKTGGSPFSPLKHHQPEKLISFANDCYDSYSESCDVEESGESEIDDPEQEEEEDSIFNNCAQLEEVQFERLGEENKDHKGQNKQKYNIYEAVMLREEIEQLRKENRVQKDELDRKSITFVELMMLREEIEQLRKENRAQKDELNQKDIICGEAMMLREEIEQLGKENRVLKDELSQKSIICGEVMMLREEIEQFRKENRTQKHELNQKDIICGKAMMPREEIEQLSKENRVMKDELNQKSIICGEVMMLKEEIEQLRKENRAQKDELHQKDNICSEIMMLREEIGQLGKENAALKDELNKKYIICGEIMMLREEIEQLRKYNRGQKNELHQKGIKCEVTMSREEKENRVKNDELNPEDSVCGEVVMLREEIKRLEKDERAQKGTLSGEVMKLRQENSAQKDHLKQKDQEKIEVIRHLSLAIDMLKQENIRMRSFIAKESSNKWKNPFGLKNFMGSLSEQLFNGITNNQPSLVAL"
     misc_feature    159..380
                     /gene="LOC108325156"
                     /note="KIP1-like protein; Region: KIP1; pfam07765"
                     /db_xref="CDD:429647"
     misc_feature    <669..>1541
                     /gene="LOC108325156"
                     /note="chromosome segregation protein SMC, common
                     bacterial type; Region: SMC_prok_B; TIGR02168"
                     /db_xref="CDD:274008"
     polyA_site      1998
                     /gene="LOC108325156"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
atataaaatggttctattctaatctcttgctcttcgtgaactctaattccatcgcaggcggtggtggcaagcattgcattaattcatgctcttggtgttcgtgataacatagacaactgaggaggagggctaaaatgatgaagaatcaaccgtcacagtggtggtggcttgagagccacagtaacacaagacgatccccttggcttcaatccactctcacagagctaaatgagaagacaaaggcaatgttaaaactaattgaagaagatgcagattcctttgcccaacgtgctgagatgtattacaagaagagaccacaacttgtgagcatggttgaagacttctataggacacatcgatcattagctgagcggtatgatcaaatcgctggaattcgtcagcagaagactggagggtcccccttttctccactcaagcatcatcaaccagagaagttgataagttttgcgaatgactgttatgatagctattctgagagttgtgatgtagaggagtctggggaatctgaaattgatgatcctgagcaagaagaggaagaggattccatattcaataactgtgcacaactggaggaagttcagtttgagagacttggtgaagagaacaaggatcataagggtcagaacaagcaaaaatataacatttacgaagcagtgatgttgagggaagaaatagagcaactcagaaaagagaacagggttcagaaggatgaactcgaccggaaaagcatcacttttgttgaattaatgatgctgagggaagaaatagagcaactaagaaaagagaatagagcacagaaggatgaactcaaccagaaagatatcatttgtggtgaagcaatgatgttgagggaagaaatagaacaactcggtaaagaaaatagagttctgaaggatgaactaagccagaaaagtatcatttgtggtgaagtaatgatgttgagggaagaaatagagcaattcagaaaagagaatagaacgcagaagcatgaactcaaccagaaagatatcatttgtggtaaagcaatgatgccgagggaagaaatagagcaactcagtaaagagaatagagttatgaaggatgaactaaaccagaaaagtatcatttgtggtgaagtaatgatgttgaaggaagaaatagagcaactcaggaaagagaatagagcgcagaaggatgaactccaccagaaagacaacatttgcagtgaaataatgatgttgagggaagaaatagggcaattgggaaaagagaatgcagcgctgaaggatgaactcaacaagaaatatatcatttgtggagaaataatgatgttgagggaagaaatagaacaactcaggaaatataatagagggcagaagaatgaactccaccagaaaggtatcaagtgtgaagtaacgatgtcgagggaagaaaaagagaatagagtgaagaatgatgaactaaacccagaagatagcgtttgtggtgaagtagtgatgttaagggaagaaataaaacgacttgaaaaagatgaaagagcacaaaaaggtaccctttctggtgaagtaatgaagttaaggcaggagaatagcgcgcagaaggaccatcttaagcaaaaagaccaagagaaaatagaggtgataagacacctgagtttagctatagatatgctgaagcaggagaacataaggatgagaagcttcattgctaaggaatcttccaacaaatggaagaatccatttgggttaaagaatttcatgggatcattatcagagcagttgtttaatggaattacaaataatcaacctagtcttgtagctctctagataaggttcacagagtaaataactaagttttgtagaacaatattaaaagatacctatgtacatgttatggggacctgctcaagtaacctacagatcttgtatacagtttagtatattcctaactaatccaagaccgagtatctagtggatttcctagacacttgtttttcta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]