GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:26:19, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_017015495            3583 bp    mRNA    linear   PRI 02-MAR-2020
DEFINITION  PREDICTED: Homo sapiens transforming acidic coiled-coil containing
            protein 2 (TACC2), transcript variant X34, mRNA.
ACCESSION   XM_017015495
VERSION     XM_017015495.2
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000010.11) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Mar 26, 2018 this sequence version replaced XM_017015495.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200228
            Annotation Version          :: 109.20200228
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3583
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
     gene            1..3583
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="transforming acidic coiled-coil containing protein
                     2; Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 7 mRNAs, 185 ESTs, 67 long SRA reads, 11
                     Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 30 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:10579"
                     /db_xref="HGNC:HGNC:11523"
                     /db_xref="MIM:605302"
     variation       4
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372817117"
     variation       5
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1474992494"
     variation       6
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1468267553"
     variation       7
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1264219317"
     variation       8
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1224421298"
     variation       9..28
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gcgcgcgccggccacactcg"
                     /replace="gcgcgcgccggccacactcgggcgcgcgccggccacactcgcgcgcgc
                     gccggccacactcg"
                     /db_xref="dbSNP:1565473727"
     variation       13
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1185632189"
     variation       24
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282914004"
     variation       26
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237262155"
     variation       27
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378692664"
     variation       28
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="ggg"
                     /db_xref="dbSNP:1375036502"
     variation       29..43
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="cgcgcacacatacgc"
                     /db_xref="dbSNP:1462507936"
     variation       29
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574777994"
     variation       34
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439909294"
     variation       35..54
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cacatacgcggcgctcgccc"
                     /replace="cacatacgcggcgctcgcccacatacgcggcgctcgccc"
                     /db_xref="dbSNP:1565473859"
     variation       37..60
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="catacgcggcgctcgccccccggc"
                     /db_xref="dbSNP:1369237309"
     variation       38
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365205996"
     variation       41
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295293683"
     variation       42
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350592367"
     variation       50
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158146670"
     variation       52
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983200476"
     variation       58
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:543498450"
     variation       61
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313845887"
     variation       62
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1355168122"
     variation       65
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557207091"
     variation       66
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1193476133"
     variation       69
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1489106131"
     variation       70
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1242000010"
     variation       74..77
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cgcg"
                     /replace="cgcgcg"
                     /db_xref="dbSNP:941464093"
     variation       75
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1355150498"
     variation       81..96
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cgc"
                     /replace="cgcagctccctgccgc"
                     /db_xref="dbSNP:1233106776"
     variation       81..83
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cgc"
                     /replace="cgcgc"
                     /db_xref="dbSNP:1038412876"
     variation       81
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565474125"
     variation       82
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576757322"
     variation       83
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387091178"
     variation       85..103
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gctccc"
                     /replace="gctccctgccgccgctccc"
                     /db_xref="dbSNP:1361226196"
     variation       87
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1296196903"
     variation       88
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398246678"
     variation       89
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948560764"
     variation       93
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1045520198"
     variation       94
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:907129697"
     variation       97
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211575219"
     variation       101
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279553222"
     variation       112
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434054875"
     variation       113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1423552655"
     variation       120
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:978156372"
     variation       122
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1489022136"
     variation       125
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206684401"
     variation       129
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053222623"
     variation       131
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:892801032"
     variation       142
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:924033957"
     variation       150
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264103242"
     variation       151
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017373732"
     variation       154
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554927445"
     variation       156
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276294969"
     variation       158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997035633"
     variation       175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455657118"
     variation       179
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298906890"
     variation       185
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029806831"
     variation       191
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955841746"
     variation       193
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1464809277"
     variation       195
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1466925113"
     variation       201
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221515512"
     variation       203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1264737825"
     variation       208
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461515725"
     variation       209
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546503601"
     variation       210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245685451"
     variation       211
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054293125"
     variation       212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186589616"
     variation       213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267323970"
     variation       216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387074372"
     variation       218
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1431911745"
     variation       219
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770243483"
     variation       220
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430353488"
     variation       223
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775917973"
     variation       224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1157131792"
     variation       230
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763366899"
     variation       231
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370483854"
     variation       232
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292994575"
     variation       234
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774491841"
     variation       238
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255892427"
     variation       240
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764046658"
     variation       241
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200245919"
     variation       242
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1402983371"
     CDS             248..3097
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /codon_start=1
                     /product="transforming acidic coiled-coil-containing
                     protein 2 isoform X33"
                     /protein_id="XP_016870984.1"
                     /db_xref="GeneID:10579"
                     /db_xref="HGNC:HGNC:11523"
                     /db_xref="MIM:605302"
                     /translation="
MGGSQSLQPAPASDLNLEASEAMSSDSEEAFETPESTTPVKAPPAPPPPPPEVIPEPEVSTQPPPEEPGCGSETVPVPDGPRSDSVEGSPFRPPSHSFSAVFDEDKPIASSGTYNLDFDNIELVDTFQTLEPRASDAKNQEGKVNTRRKSTDSVPISKSTLSRSLSLQASDFDGASSSGNPEAVALAPDAYSTGSSSASSTLKRTKKPRPPSLKKKQTTKKPTETPPVKETQQEPDEESLVPSGENLASETKTESAKTEGPSPALLEETPLEPAVGPKAACPLDSESAEGVVPPASGGGRVQNSPPVGRKTLPLTTAPEAGEVTPSDSGGQEDSPAKGLSVRLEFDYSEDKSSWDNQQENPPPTKKIGKKPVAKMPLRRPKMKKTPEKLDNTPASPPRSPAEPNDIPIAKGTYTFDIDKWDDPNFNPFSSTSKMQESPKLPQQSYNFDPDTCDESVDPFKTSSKTPSSPSKSPASFEIPASAMEANGVDGDGLNKPAKKKKTPLKTDTFRVKKSPKRSPLSDPPSQDPTPAATPETPPVISAVVHATDEEKLAVTNQKWTCMTVDLEADKQDYPQPSDLSTFVNETKFSSPTEELDYRNSYEIEYMEKIGSSLPQDDDAPKKQALYLMFDTSQESPVKSSPVRMSESPTPCSGSSFEETEALVNTAAKNQHPVPRGLAPNQESHLQVPEKSSQKELEAMGLGTPSEAIEIREAAHPTDVSISKTALYSRIGTAEVEKPAGLLFQQPDLDSALQIARAEIITKEREVSEWKDKYEESRREVMEMRKIVAEYEKTIAQMIEDEQREKSVSHQTVQQLVLEKEQALADLNSVEKSLADLFRRYEKMKEVLEGFRKNEEVLKRCAQEYLSRVKKEEQRYQALKVHAEEKLDRANAEIAQVRGKAQQEQAAHQASLRKEQLRVDALERTLEQKNKEIEELTKICDELIAKMGKS"
     variation       249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284984497"
     variation       250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:868684964"
     variation       255
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:908574082"
     variation       259
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323925091"
     variation       262
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762055853"
     variation       264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281791698"
     variation       265
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315182403"
     variation       267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1226777064"
     variation       268
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318324556"
     variation       271
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1369775931"
     variation       272
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:866002276"
     variation       273
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767587456"
     variation       274
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144604119"
     variation       275
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1467477398"
     variation       276
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401667958"
     variation       277
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138505408"
     variation       278
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759489710"
     variation       280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270055412"
     variation       281
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369692139"
     variation       282
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765158678"
     variation       284
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776515408"
     variation       289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758197605"
     variation       290
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867965349"
     variation       292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235934448"
     variation       295
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180281870"
     variation       301
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401472387"
     variation       302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764008950"
     variation       303
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868734879"
     variation       309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348152648"
     variation       313
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751205457"
     variation       315
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757017069"
     variation       316
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1267804748"
     variation       322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756957694"
     variation       334
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303739623"
     variation       343
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767142432"
     variation       349
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750095297"
     variation       357
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447537978"
     variation       358
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198528351"
     variation       361
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755521071"
     variation       366
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201603538"
     variation       371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1555121169"
     variation       375
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140413175"
     variation       376
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201214429"
     variation       382
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362915299"
     variation       382
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1555121236"
     variation       383..399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccacccccaccaccccc"
                     /replace="ccacccccaccacccccaccaccccc"
                     /db_xref="dbSNP:34095801"
     variation       383
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1451142111"
     variation       384
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455549169"
     variation       386..390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:1159831976"
     variation       386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384973683"
     variation       387
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424586328"
     variation       389
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301905535"
     variation       390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755517441"
     variation       391..394
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="acca"
                     /db_xref="dbSNP:1318215449"
     variation       391
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779223549"
     variation       393
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565571513"
     variation       394
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748566906"
     variation       395..400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1565571647"
     variation       395
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773254764"
     variation       396
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770879290"
     variation       397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1241392502"
     variation       398
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776893320"
     variation       399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:58106543"
     variation       400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220348519"
     variation       401
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765054573"
     variation       402
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1490814775"
     variation       403
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368856332"
     variation       411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313463255"
     variation       412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432963606"
     variation       413
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961067010"
     variation       415
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765841579"
     variation       418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138045107"
     variation       419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140976774"
     variation       423
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1382634186"
     variation       426
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149503672"
     variation       427
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183446641"
     variation       428
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364012217"
     variation       433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758645827"
     variation       434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778234573"
     variation       441
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532281287"
     variation       442
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144751396"
     variation       450
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177703431"
     variation       453..467
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="gatgtggttctgaga"
                     /db_xref="dbSNP:1187559665"
     variation       453
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868704474"
     variation       456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565627967"
     variation       458
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776454653"
     variation       459
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479692439"
     variation       462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948411212"
     variation       466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202010230"
     variation       468
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745501319"
     variation       473
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769496601"
     variation       478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774860841"
     variation       480
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175221066"
     variation       483
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762460420"
     variation       486
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479278284"
     variation       489
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268820302"
     variation       491
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763525770"
     variation       492
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373068885"
     variation       496
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762441531"
     variation       497
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402926596"
     variation       500
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1284928578"
     variation       501
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376162843"
     variation       502..506
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gg"
                     /replace="ggtgg"
                     /db_xref="dbSNP:1031378520"
     variation       502
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756389507"
     variation       506
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329642994"
     variation       509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766688126"
     variation       512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262320291"
     variation       515
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866000543"
     variation       521
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148110955"
     variation       522
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370799288"
     variation       524
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216683665"
     variation       525
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219899214"
     variation       526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1291747880"
     variation       527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1361812227"
     variation       528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564717762"
     variation       529
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143883746"
     variation       535
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780955004"
     variation       536
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437946703"
     variation       537
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166796802"
     variation       538..542
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:773619764"
     variation       541
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389808854"
     variation       543
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745730679"
     variation       547
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769483248"
     variation       548
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008585258"
     variation       550
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775150815"
     variation       553..554
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:761300973"
     variation       553
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748916908"
     variation       554
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773774461"
     variation       555
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762386374"
     variation       556..557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:771538634"
     variation       556
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772763191"
     variation       557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761051733"
     variation       560
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766662877"
     variation       562
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201905665"
     variation       565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759721170"
     variation       567
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441037916"
     variation       577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296165600"
     variation       580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375033420"
     variation       584
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240305957"
     variation       595
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765341262"
     variation       596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176088242"
     variation       598
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313678251"
     variation       599
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427434133"
     variation       601
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357969883"
     variation       602
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022571261"
     variation       606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291054240"
     variation       608
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:964270789"
     variation       609
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967106481"
     variation       610
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752835692"
     variation       613
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773783823"
     variation       617..620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gtgg"
                     /replace="gtggtgg"
                     /db_xref="dbSNP:777232638"
     variation       617
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029661399"
     variation       618
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183086070"
     variation       624
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1241309431"
     variation       629
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1442703845"
     variation       633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165326358"
     variation       638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116183037"
     variation       641
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750376265"
     variation       642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755889268"
     variation       644
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376786391"
     variation       645
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540765159"
     variation       648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560482573"
     variation       654
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373908144"
     variation       655
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370168206"
     variation       656
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529296575"
     variation       666
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771710153"
     variation       671
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:916176525"
     variation       674
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213227589"
     variation       678
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275492631"
     variation       679
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1303099860"
     variation       682
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773794685"
     variation       686
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761282634"
     variation       687
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771284294"
     variation       688
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1462754633"
     variation       689
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776913120"
     variation       690
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275479836"
     variation       691
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549215108"
     variation       699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475016676"
     variation       700
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765447651"
     variation       702
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1181469493"
     variation       705
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1425362468"
     variation       706
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752923829"
     variation       707
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199696107"
     variation       710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1175338836"
     variation       711
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1254138834"
     variation       714
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7083331"
     variation       717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272564235"
     variation       721
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191111839"
     variation       723
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756044688"
     variation       725
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779876538"
     variation       726
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1334222006"
     variation       727
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753632492"
     variation       730
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200529740"
     variation       733
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272291538"
     variation       734
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747813403"
     variation       735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771655052"
     variation       736
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1261569123"
     variation       738
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111994437"
     variation       739
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747532165"
     variation       742
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283604528"
     variation       745
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372635027"
     variation       748
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213489310"
     variation       755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777051347"
     variation       760
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342604887"
     variation       765
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906864557"
     variation       769
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746155868"
     variation       770
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198381623"
     variation       779
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426827893"
     variation       783
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1390452206"
     variation       786
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3750843"
     variation       790
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172685149"
     variation       791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775643365"
     variation       793
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1383528125"
     variation       794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143340046"
     variation       796
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764129065"
     variation       797
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114995590"
     variation       800
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376178888"
     variation       802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766292512"
     variation       803
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760159868"
     variation       807
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753817518"
     variation       811
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279050241"
     variation       814
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754669268"
     variation       815
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765143512"
     variation       816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288126420"
     variation       817
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752353928"
     variation       818
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758161048"
     variation       820
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777412834"
     variation       821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746572352"
     variation       823
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565631962"
     variation       825
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756797942"
     variation       826
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781496938"
     variation       828
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199969252"
     variation       838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468212441"
     variation       840
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770104155"
     variation       841
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957496572"
     variation       844
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268321360"
     variation       845
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1381505226"
     variation       847
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1424544716"
     variation       850
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1208559524"
     variation       851
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029876000"
     variation       858
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775874142"
     variation       870
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749489269"
     variation       871
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139376398"
     variation       873
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774482969"
     variation       876
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202246830"
     variation       877
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:79619171"
     variation       879
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150034118"
     variation       882
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867989093"
     variation       886..891
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1447689928"
     variation       887
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868039262"
     variation       891
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866202883"
     variation       895
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759573053"
     variation       896
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1289335828"
     variation       900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358270530"
     variation       903
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210204744"
     variation       910
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765090078"
     variation       911
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435669586"
     variation       913
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1300809535"
     variation       921..927
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:759725298"
     variation       922
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1180009063"
     variation       926
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139868428"
     variation       927
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183608136"
     variation       929
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751241062"
     variation       935
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115286612"
     variation       937
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780787166"
     variation       939
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538567560"
     variation       940
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114199549"
     variation       948
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749720151"
     variation       949
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1332128588"
     variation       951
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769011931"
     variation       955
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915739324"
     variation       963
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196937628"
     variation       965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:948515169"
     variation       967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778943409"
     variation       968
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312917152"
     variation       970
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748421472"
     variation       971
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1245301953"
     variation       972
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145907362"
     variation       975
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1250514618"
     variation       977
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554116886"
     variation       984
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202181709"
     variation       991
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375248756"
     variation       993
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934338274"
     variation       995
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463797112"
     variation       999
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773378377"
     variation       1000
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759521622"
     variation       1002
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769922555"
     variation       1003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775575434"
     variation       1004
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424854899"
     variation       1005
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146669395"
     variation       1006
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371630068"
     variation       1007
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467391447"
     variation       1013
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171725889"
     variation       1020
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777280236"
     variation       1021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370832508"
     variation       1026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115985418"
     variation       1027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1381295430"
     variation       1033
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750005707"
     variation       1034
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294603489"
     variation       1037
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:914335011"
     variation       1038
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944637263"
     variation       1039
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756607567"
     variation       1043
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369583357"
     variation       1046
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378317701"
     variation       1049
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755283163"
     variation       1053
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114927453"
     variation       1054
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35913854"
     variation       1055
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772383562"
     variation       1058
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747020874"
     variation       1064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371355623"
     variation       1066
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151005188"
     variation       1067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763017330"
     variation       1070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768305770"
     variation       1071
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2295873"
     variation       1072
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761359884"
     variation       1074
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359759378"
     variation       1075
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767266341"
     variation       1076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760120159"
     variation       1077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765895151"
     variation       1083
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331893143"
     variation       1088
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754298643"
     variation       1089
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298529946"
     variation       1091
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755545115"
     variation       1092
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779121471"
     variation       1094
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775097315"
     variation       1097
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753160407"
     variation       1099
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312322640"
     variation       1101
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015585332"
     variation       1102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758697172"
     variation       1105
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150139481"
     variation       1106
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138777606"
     variation       1109
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:556551802"
     variation       1110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2295874"
     variation       1114
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768698106"
     variation       1115
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426135698"
     variation       1117
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368777371"
     variation       1121
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747907952"
     variation       1123..1128
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:765296364"
     variation       1123
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771776690"
     variation       1124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298586776"
     variation       1125
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364667209"
     variation       1127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434010762"
     variation       1128
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2295875"
     variation       1129
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149346540"
     variation       1130
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1390363878"
     variation       1131
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306390301"
     variation       1135
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932746007"
     variation       1136
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765839539"
     variation       1137
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:955968932"
     variation       1138
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291676037"
     variation       1143
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776164733"
     variation       1146
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224202036"
     variation       1147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759943943"
     variation       1150
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371850863"
     variation       1151
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753159948"
     variation       1156
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758745427"
     variation       1157
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275295684"
     variation       1160
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441479270"
     variation       1162
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554653985"
     variation       1163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405097009"
     variation       1166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144863138"
     variation       1167
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781409575"
     variation       1168
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202168550"
     variation       1169
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756151344"
     variation       1171
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040284989"
     variation       1172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547042157"
     variation       1177
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461134307"
     variation       1179
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778850142"
     variation       1180
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748058471"
     variation       1183
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771859124"
     variation       1184
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773027256"
     variation       1185
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363135915"
     variation       1186
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746637680"
     variation       1187
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770625460"
     variation       1190
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1169750358"
     variation       1191
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290989544"
     variation       1194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776111533"
     variation       1195
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759031402"
     variation       1198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260219289"
     variation       1199
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1458324936"
     variation       1200
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375927409"
     variation       1201
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776030064"
     variation       1202
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772054587"
     variation       1207
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567258547"
     variation       1209
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054109938"
     variation       1210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752028950"
     variation       1212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:892825068"
     variation       1215
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004463763"
     variation       1218
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168179643"
     variation       1224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:575786348"
     variation       1225
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35532970"
     variation       1228
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780028150"
     variation       1229
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369011900"
     variation       1231
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148585687"
     variation       1232..1237
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:752879677"
     variation       1232
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114482287"
     variation       1234
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:907333113"
     variation       1236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745542749"
     variation       1237
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769319405"
     variation       1248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774912294"
     variation       1250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763504346"
     variation       1251
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769355165"
     variation       1252
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203132721"
     variation       1253
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775004619"
     variation       1254
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762208855"
     variation       1255
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198068596"
     variation       1257
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1212228565"
     variation       1259
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1003015440"
     variation       1261
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114946191"
     variation       1262
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477398525"
     variation       1263
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2295876"
     variation       1264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373331825"
     variation       1267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75938210"
     variation       1268
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187285591"
     variation       1270
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956189831"
     variation       1273
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422377862"
     variation       1275
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201583201"
     variation       1277
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758324126"
     variation       1279
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143290941"
     variation       1290
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751522644"
     variation       1294
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11200483"
     variation       1296
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373769936"
     variation       1298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:745516639"
     variation       1304
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769391107"
     variation       1306
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779612306"
     variation       1309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748741805"
     variation       1310
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211812468"
     variation       1312
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388343217"
     variation       1318
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139126450"
     variation       1320
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774947544"
     variation       1326
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487895676"
     variation       1327
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282699180"
     variation       1331
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762439872"
     variation       1332
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543214534"
     variation       1334
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:985529652"
     variation       1338
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264979872"
     variation       1339
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430980605"
     variation       1344
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488422146"
     variation       1346
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921705233"
     variation       1347
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543134454"
     variation       1349
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478746956"
     variation       1361
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773494596"
     variation       1368
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777183522"
     variation       1370
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944497773"
     variation       1372
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448852295"
     variation       1374
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766573375"
     variation       1390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361503258"
     variation       1391
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1404718695"
     variation       1398
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975894274"
     variation       1401
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200197716"
     variation       1402
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200903142"
     variation       1404
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765335838"
     variation       1405
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116727041"
     variation       1406
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948396343"
     variation       1410
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237798802"
     variation       1412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757238700"
     variation       1413
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:558512351"
     variation       1415
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370847934"
     variation       1418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755943697"
     variation       1419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779516893"
     variation       1421
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198989164"
     variation       1427
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374042332"
     variation       1428
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301866447"
     variation       1429
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002609375"
     variation       1436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868694930"
     variation       1437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438395704"
     variation       1438
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754496276"
     variation       1443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778605279"
     variation       1444
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765911016"
     variation       1448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753269912"
     variation       1453
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773617869"
     variation       1455
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747267478"
     variation       1457
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360376530"
     variation       1458
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771337694"
     variation       1469
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776679676"
     variation       1472
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149875675"
     variation       1474
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765282692"
     variation       1479
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954043928"
     variation       1481
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1044360808"
     variation       1486
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775608705"
     variation       1487
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243822780"
     variation       1488
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761734973"
     variation       1494
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767291670"
     variation       1497
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750389683"
     variation       1504
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255268589"
     variation       1510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1181478921"
     variation       1513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1019634630"
     variation       1515
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:905990877"
     variation       1518
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755818965"
     variation       1522
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1211698784"
     variation       1527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1342007948"
     variation       1528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377341447"
     variation       1530
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763469698"
     variation       1536
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423707190"
     variation       1537
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754726978"
     variation       1538
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111795908"
     variation       1540
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778549690"
     variation       1550
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473323611"
     variation       1551
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:564839203"
     variation       1554
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1170321699"
     variation       1555
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747723437"
     variation       1559
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757927053"
     variation       1565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778080991"
     variation       1568
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372505760"
     variation       1569
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377103453"
     variation       1570
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395314344"
     variation       1573
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771171727"
     variation       1575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1342098788"
     variation       1588
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373771227"
     variation       1591
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199568460"
     variation       1595
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746080998"
     variation       1599
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370327996"
     variation       1600
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315632999"
     variation       1609
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770069199"
     variation       1611
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955858634"
     variation       1612
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375899573"
     variation       1613
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183996280"
     variation       1616
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1258869046"
     variation       1618
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443397153"
     variation       1622
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768804346"
     variation       1628
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421786447"
     variation       1632
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162433155"
     variation       1633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375253951"
     variation       1635
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763304795"
     variation       1637
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766065502"
     variation       1641
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482751047"
     variation       1643
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914485703"
     variation       1644
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753744351"
     variation       1646
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372356560"
     variation       1653
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764912468"
     variation       1656
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145140872"
     variation       1661
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337977662"
     variation       1662
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116623673"
     variation       1663
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928356195"
     variation       1667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311174434"
     variation       1669
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569523562"
     variation       1670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186794327"
     variation       1671
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565642151"
     variation       1672
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346266225"
     variation       1679
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216381943"
     variation       1680
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757845073"
     variation       1681
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312989990"
     variation       1685
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1489399224"
     variation       1687
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577051130"
     variation       1693
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194723044"
     variation       1695
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1266933346"
     variation       1697
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781537142"
     variation       1701
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036743578"
     variation       1704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:267602392"
     variation       1707
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746165255"
     variation       1708
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770159087"
     variation       1709
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143162487"
     variation       1714
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763545893"
     variation       1715
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768585905"
     variation       1716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774537634"
     variation       1718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760516162"
     variation       1719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147830187"
     variation       1722
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384589949"
     variation       1733
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868858086"
     variation       1735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776710818"
     variation       1736
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:552066251"
     variation       1739..1751
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aagaagaaga"
                     /replace="aagaagaagaaga"
                     /replace="aagaagaagaagaaga"
                     /db_xref="dbSNP:763225454"
     variation       1740
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239985315"
     variation       1750
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571963100"
     variation       1752
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:907564066"
     variation       1753
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762718237"
     variation       1756
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763502836"
     variation       1764
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940269349"
     variation       1771
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776350847"
     variation       1774
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755319544"
     variation       1788
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765550124"
     variation       1789
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577237580"
     variation       1790
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192448554"
     variation       1793
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1325364389"
     variation       1796
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200244150"
     variation       1797
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141312062"
     variation       1798
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052019119"
     variation       1800
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243462986"
     variation       1802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911861882"
     variation       1803
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565655710"
     variation       1809
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779997033"
     variation       1812
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749217706"
     variation       1815
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382353255"
     variation       1816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430079078"
     variation       1818
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178012692"
     variation       1821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768469173"
     variation       1823
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778624614"
     variation       1828
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:879004195"
     variation       1829
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767624278"
     variation       1831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142595789"
     variation       1832
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:971377205"
     variation       1833
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051132992"
     variation       1839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756220208"
     variation       1840
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373229304"
     variation       1841
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168974129"
     variation       1844
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116132466"
     variation       1849
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1213747876"
     variation       1853
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758150082"
     variation       1854
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438338538"
     variation       1858
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746649237"
     variation       1861
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364796890"
     variation       1867
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472673300"
     variation       1870
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908637736"
     variation       1872
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201442031"
     variation       1873
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780903530"
     variation       1882
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139131571"
     variation       1885
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377572872"
     variation       1888
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330722147"
     variation       1906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769368467"
     variation       1912
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749854819"
     variation       1914
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538432507"
     variation       1915
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774916657"
     variation       1921
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1243751002"
     variation       1925
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898397711"
     variation       1926
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34944231"
     variation       1927
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767565546"
     variation       1929
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256793659"
     variation       1931
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150404273"
     variation       1937
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766476440"
     variation       1942
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453396717"
     variation       1943
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251833616"
     variation       1944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752599030"
     variation       1946
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758378142"
     variation       1951
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420340279"
     variation       1965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1376263819"
     variation       1968
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370266697"
     variation       1969
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35095099"
     variation       1971
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1376331548"
     variation       1974
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375024095"
     variation       1975
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745566133"
     variation       1977
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755658158"
     variation       1978
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149645012"
     variation       1982
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749802502"
     variation       1986
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866276961"
     variation       1989
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395262725"
     variation       1990
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769356942"
     variation       1996
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565662328"
     variation       1999..2005
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cgagacc"
                     /replace="cgagaccgagacc"
                     /db_xref="dbSNP:1371086471"
     variation       1999
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774923755"
     variation       2001
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748401716"
     variation       2003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013086937"
     variation       2005
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1277178257"
     variation       2008
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772504256"
     variation       2010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868356760"
     variation       2013
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773263407"
     variation       2016
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760995785"
     variation       2018
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344881290"
     variation       2025
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199102821"
     variation       2027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766423134"
     variation       2032
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771981610"
     variation       2033
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:956752475"
     variation       2038
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473981288"
     variation       2040
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773293574"
     variation       2045
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565690430"
     variation       2046
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867288575"
     variation       2047
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146144060"
     variation       2049
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373895280"
     variation       2050
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753506322"
     variation       2052
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1356739937"
     variation       2059
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750288599"
     variation       2061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759309486"
     variation       2063
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407206360"
     variation       2064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12268154"
     variation       2067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467568269"
     variation       2076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1302564812"
     variation       2079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764639479"
     variation       2080
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752316295"
     variation       2082
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757848963"
     variation       2087
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317421107"
     variation       2091
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779179692"
     variation       2093
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552517660"
     variation       2095
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771056377"
     variation       2096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776714808"
     variation       2098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138976635"
     variation       2099
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373262025"
     variation       2100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236227348"
     variation       2102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303801895"
     variation       2103
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376832058"
     variation       2104
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762563927"
     variation       2106
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369295547"
     variation       2107
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773920791"
     variation       2108
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447130895"
     variation       2113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212473116"
     variation       2116
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761319926"
     variation       2117
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748599613"
     variation       2130
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1268085020"
     variation       2137
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435239520"
     variation       2139
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1194666228"
     variation       2140
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268502166"
     variation       2142
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453432073"
     variation       2144
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1185556095"
     variation       2151
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363639492"
     variation       2152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767958887"
     variation       2155
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142125896"
     variation       2156
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147714181"
     variation       2164
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114701221"
     variation       2165
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534941686"
     variation       2170
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373168589"
     variation       2171
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139196844"
     variation       2174
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188626786"
     variation       2175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:115880388"
     variation       2177
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781226002"
     variation       2179
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334995033"
     variation       2184
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745833341"
     variation       2186
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543630960"
     variation       2187
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350887064"
     variation       2188
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779772714"
     variation       2189
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270664849"
     variation       2190
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61730787"
     variation       2191
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774010181"
     variation       2193
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922043946"
     variation       2194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436479863"
     variation       2196
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772560651"
     variation       2197
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771598263"
     variation       2198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377342486"
     variation       2199
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761132977"
     variation       2214
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761236862"
     variation       2218
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771274057"
     variation       2224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914900340"
     variation       2228
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777206576"
     variation       2234
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:969334372"
     variation       2235
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564397839"
     variation       2238
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288294653"
     variation       2239
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775833159"
     variation       2241..2247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ctgc"
                     /replace="ctgctgc"
                     /db_xref="dbSNP:1230344014"
     variation       2243
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271256611"
     variation       2244
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763325586"
     variation       2246
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764232214"
     variation       2247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111666066"
     variation       2248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751529875"
     variation       2250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233166862"
     variation       2259
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757374526"
     variation       2262
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1259806348"
     variation       2264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766182197"
     variation       2269
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753808693"
     variation       2270
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754732462"
     variation       2271
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453598568"
     variation       2282
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778724348"
     variation       2287
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376976062"
     variation       2293
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371140295"
     variation       2297
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777485343"
     variation       2298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746443975"
     variation       2302..2305
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gcag"
                     /db_xref="dbSNP:1382193243"
     variation       2302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770495746"
     variation       2303
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776962329"
     variation       2304
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370858692"
     variation       2306
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200541273"
     variation       2312
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770269399"
     variation       2313
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577886780"
     variation       2317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359145924"
     variation       2322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238683112"
     variation       2325
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930801970"
     variation       2327
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004976434"
     variation       2332
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203463385"
     variation       2333
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565704868"
     variation       2336
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763416174"
     variation       2339
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775393485"
     variation       2341..2343
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cat"
                     /replace="catcat"
                     /db_xref="dbSNP:1248601100"
     variation       2346
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467925153"
     variation       2350
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201932773"
     variation       2352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114249776"
     variation       2353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267979086"
     variation       2354
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761762767"
     variation       2355
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528927715"
     variation       2357
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753749581"
     variation       2363
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361658773"
     variation       2367
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150511831"
     variation       2368
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944965247"
     variation       2371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1394419746"
     variation       2382
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300712545"
     variation       2383
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141377067"
     variation       2388
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396085567"
     variation       2391
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484129399"
     variation       2397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767823235"
     variation       2400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750641625"
     variation       2401
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145232984"
     variation       2402
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2295878"
     variation       2406
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867736580"
     variation       2408
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753914817"
     variation       2415
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232416465"
     variation       2418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755134815"
     variation       2419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1007551291"
     variation       2420
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777816912"
     variation       2422
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746985859"
     variation       2425
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770738881"
     variation       2430
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148958039"
     variation       2431
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745530967"
     variation       2432
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776539571"
     variation       2433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759597676"
     variation       2435
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775145955"
     variation       2437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762408075"
     variation       2438
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61753077"
     variation       2439
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866260474"
     variation       2443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762281778"
     variation       2444
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2295879"
     variation       2446
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761809326"
     variation       2451
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176369997"
     variation       2452..2453
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:747741502"
     variation       2454
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370782961"
     variation       2459
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766663899"
     variation       2462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1368553884"
     variation       2467
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536628094"
     variation       2477
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866691058"
     variation       2483
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755079853"
     variation       2485
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765459460"
     variation       2486
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75671139"
     variation       2489
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145179415"
     variation       2495
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252684363"
     variation       2498
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139008883"
     variation       2499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336971324"
     variation       2501
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745600319"
     variation       2509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268666853"
     variation       2510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538968585"
     variation       2513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189176188"
     variation       2516
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449661928"
     variation       2517
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779648529"
     variation       2520
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448067248"
     variation       2521
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748986288"
     variation       2522
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747566067"
     variation       2529
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771648191"
     variation       2530
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369002161"
     variation       2533
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1564793181"
     variation       2536
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:975775977"
     variation       2541
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291433586"
     variation       2549
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377060915"
     variation       2562
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747603637"
     variation       2569
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912316468"
     variation       2578
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771411616"
     variation       2580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372697264"
     variation       2587
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227342028"
     variation       2588
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:978317426"
     variation       2599
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564820315"
     variation       2600
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75080758"
     variation       2601
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370762796"
     variation       2602
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746194917"
     variation       2604
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770322124"
     variation       2611
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775552173"
     variation       2614
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142193513"
     variation       2619
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423272950"
     variation       2620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867489356"
     variation       2629
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768612291"
     variation       2633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1176806548"
     variation       2636
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774419561"
     variation       2639
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761890514"
     variation       2641
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318429487"
     variation       2644
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478990548"
     variation       2647
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368788180"
     variation       2648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762669751"
     variation       2656
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414112797"
     variation       2659
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:267602393"
     variation       2661
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1470506018"
     variation       2663
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763754108"
     variation       2665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751297161"
     variation       2668
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406827536"
     variation       2670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226848799"
     variation       2671
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756806235"
     variation       2673
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1019037833"
     variation       2676
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407465849"
     variation       2677
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309376878"
     variation       2679
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576383974"
     variation       2681
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750960872"
     variation       2691
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756574052"
     variation       2713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1358939475"
     variation       2714
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780436891"
     variation       2719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:545114672"
     variation       2731
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201589274"
     variation       2732
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146365438"
     variation       2744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252717696"
     variation       2749
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114739516"
     variation       2750
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772127891"
     variation       2758
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527587471"
     variation       2765
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747065222"
     variation       2767
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149487619"
     variation       2775
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143941520"
     variation       2776
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343531337"
     variation       2782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762769351"
     variation       2785
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170065040"
     variation       2788
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396657872"
     variation       2790
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763843707"
     variation       2794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774133362"
     variation       2798
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761622230"
     variation       2799
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767282216"
     variation       2800
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749892480"
     variation       2801
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755599004"
     variation       2812
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760029955"
     variation       2821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765741125"
     variation       2823
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190199335"
     variation       2826
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262009486"
     variation       2829
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432296611"
     variation       2830
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753003533"
     variation       2833
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1564874083"
     variation       2836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758787417"
     variation       2838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480448917"
     variation       2840
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159111751"
     variation       2844
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777932612"
     variation       2846
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751771255"
     variation       2847
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372413580"
     variation       2860
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781195910"
     variation       2874
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1385348085"
     variation       2879
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303647079"
     variation       2885
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237279577"
     variation       2889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745963821"
     variation       2890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554081729"
     variation       2892
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779013734"
     variation       2893
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376082640"
     variation       2902
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1213968702"
     variation       2903
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772029008"
     variation       2905
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406473528"
     variation       2906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261162550"
     variation       2908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1488018630"
     variation       2916
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746827175"
     variation       2928
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770435787"
     variation       2929
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309438773"
     variation       2931
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776369229"
     variation       2937
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564879870"
     variation       2938
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1177930005"
     variation       2943
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547685475"
     variation       2944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:567661733"
     variation       2945
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745678131"
     variation       2949
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316975899"
     variation       2950
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359848003"
     variation       2960
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227277077"
     variation       2961
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763517853"
     variation       2962
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368557628"
     variation       2963
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114931291"
     variation       2966
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750694570"
     variation       2967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1482596204"
     variation       2974
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373294737"
     variation       2976
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:56075957"
     variation       2977
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:915433777"
     variation       2980
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:934534722"
     variation       2981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449221633"
     variation       2982
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186937744"
     variation       2983
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752680886"
     variation       2990
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1410614727"
     variation       2997
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758346924"
     variation       2999
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357493288"
     variation       3000
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1464517939"
     variation       3002
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777783896"
     variation       3003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383284248"
     variation       3004
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780060707"
     variation       3005
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757107024"
     variation       3006
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1363564488"
     variation       3010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780680174"
     variation       3017
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745570983"
     variation       3018
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769288113"
     variation       3019
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201638112"
     variation       3020
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1166152334"
     variation       3026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376457806"
     variation       3032
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564914901"
     variation       3040
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276851285"
     variation       3042
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220908859"
     variation       3054
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768248413"
     variation       3067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779260986"
     variation       3068
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311935453"
     variation       3070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748744464"
     variation       3073
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772316313"
     variation       3080
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773647485"
     variation       3092
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360412716"
     variation       3096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771233836"
     variation       3098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866915985"
     variation       3100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777028253"
     variation       3101
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902027065"
     variation       3103
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1172721621"
     variation       3106
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759504397"
     variation       3107
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377142183"
     variation       3110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1351888215"
     variation       3111
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416840704"
     variation       3113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1187544287"
     variation       3121
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751439925"
     variation       3122
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:547512577"
     variation       3124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361936110"
     variation       3128
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223497421"
     variation       3130
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3763763"
     variation       3131
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750169900"
     variation       3136
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755933143"
     variation       3138
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234496958"
     variation       3143
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374823698"
     variation       3144
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777282532"
     variation       3145
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201048578"
     variation       3146
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753572151"
     variation       3147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006629992"
     variation       3149
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754430244"
     variation       3151
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778549316"
     variation       3152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369424351"
     variation       3157
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747619110"
     variation       3158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772575740"
     variation       3164
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778450017"
     variation       3171
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1046622000"
     variation       3173
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447930166"
     variation       3175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282865623"
     variation       3180
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747341499"
     variation       3183
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771462938"
     variation       3186
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759862926"
     variation       3188
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769760312"
     variation       3191
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775580610"
     variation       3195
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275047558"
     variation       3198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181521772"
     variation       3199
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:569504865"
     variation       3202
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750399176"
     variation       3203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959269055"
     variation       3204
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446174545"
     variation       3211
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416315388"
     variation       3214..3216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1183854936"
     variation       3214
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1389099504"
     variation       3223..3230
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="taaa"
                     /replace="taaataaa"
                     /db_xref="dbSNP:751463672"
     variation       3224..3232
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaat"
                     /replace="aaataaaat"
                     /db_xref="dbSNP:774569712"
     variation       3227
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1169201175"
     variation       3231
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760437099"
     variation       3233
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766216318"
     variation       3236..3238
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1458552102"
     variation       3236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272959843"
     variation       3238
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753425741"
     variation       3239
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219898335"
     variation       3248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748877620"
     variation       3250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408793518"
     variation       3259..3261
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aga"
                     /db_xref="dbSNP:1453790729"
     variation       3263
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:762007046"
     variation       3264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363223209"
     variation       3268
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1024739984"
     variation       3280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374062655"
     variation       3296
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:966946959"
     variation       3298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977836267"
     variation       3301
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1270884083"
     variation       3308
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344366660"
     variation       3316
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199822541"
     variation       3331
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778446734"
     variation       3332
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1462490128"
     variation       3337
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370234122"
     variation       3339
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1203996663"
     variation       3344
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247168452"
     variation       3345
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291714220"
     variation       3357
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036258557"
     variation       3362
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1459287529"
     variation       3371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898819681"
     variation       3385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1224122716"
     variation       3392
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165778617"
     variation       3394
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778166644"
     variation       3401
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1419286233"
     variation       3407
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1262422910"
     variation       3411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1180522218"
     variation       3414
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440380617"
     variation       3436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321148976"
     variation       3442
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189949768"
     variation       3443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1028662571"
     variation       3446
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305248145"
     variation       3450
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1032499439"
     variation       3452
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350982712"
     variation       3460
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287705618"
     variation       3462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:878864233"
     variation       3463
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:15151"
     variation       3468
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240327071"
     variation       3471..3473
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:957852098"
     variation       3477
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747511945"
     variation       3478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388396106"
     variation       3487
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368077329"
     variation       3489
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770390619"
     variation       3493
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185822401"
     variation       3498
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558060686"
     variation       3499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967563460"
     variation       3506..3510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tttt"
                     /replace="ttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:910920936"
     variation       3511..3517
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:112509232"
     variation       3511
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:191421130"
     variation       3512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976351124"
     variation       3515
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1160673944"
     variation       3519
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1420425324"
     variation       3526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:35785098"
     variation       3528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977657785"
     variation       3529
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174596543"
     variation       3544..3557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tctctattgtaaat"
                     /db_xref="dbSNP:1435360193"
     variation       3546
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1268515894"
     variation       3547
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193473691"
     variation       3559
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487511484"
     variation       3561
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:929454719"
     variation       3562
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1033234149"
     variation       3576
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047929684"
     variation       3580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147236944"
ORIGIN      
acactcgggcgcgcgccggccacactcgcgcgcacacatacgcggcgctcgccccccggcccccggctcgggccgcgagtcgcagctccctgccgccgctcccgccgccacggatgcccgcagctgctcccctctgcagtgcagcaaccccggccgccggccggctcgccccggctcccggctgcaggaatcgcgccaggacgctggccccgctcgcggctagcttgcacgccagggcacagcgaggatgggagggtcgcagtccctgcagccagccccagccagcgacctgaacctggaggcttccgaggcaatgagttccgattctgaagaggcatttgagaccccggagtcaacgacccctgtcaaagctccgccagctccacccccaccaccccccgaagtcatcccagaacccgaggtcagcacacagccacccccggaagaaccaggatgtggttctgagacagtccctgtccctgatggcccacggagcgactcggtggaaggaagtcccttccgtcccccgtcacactccttctctgccgtcttcgatgaagacaagccgatagccagcagtgggacttacaacttggactttgacaacattgagcttgtggatacctttcagaccttggagcctcgtgcctcagacgctaagaatcaggagggcaaagtgaacacacggaggaagtccacggattccgtccccatctctaagtctacactgtcccggtcgctcagcctgcaagccagtgactttgatggtgcttcttcctcaggcaatcccgaggccgtggcccttgccccagatgcatatagcacgggttccagcagtgcttctagtacccttaagcgaactaaaaaaccgaggccgccttccttaaaaaagaaacagaccaccaagaaacccacagagacccccccagtgaaggagacgcaacaggagccagatgaagagagccttgtccccagtggggagaatctagcatctgagacgaaaacggaatctgccaagacggaaggtcctagcccagccttattggaggagacgccccttgagcccgctgtggggcccaaagctgcctgccctctggactcagagagtgcagaaggggttgtccccccggcttctggaggtggcagagtgcagaactcaccccctgtcgggaggaaaacgctgcctcttaccacggccccggaggcaggggaggtaaccccatcggatagcggggggcaagaggactctccagccaaagggctctccgtaaggctggagtttgactattctgaggacaagagtagttgggacaaccagcaggaaaacccccctcctaccaaaaagataggcaaaaagccagttgccaaaatgcccctgaggaggccaaagatgaaaaagacacccgagaaacttgacaacactcctgcctcacctcccagatcccctgctgaacccaatgacatccccattgctaaaggtacttacacctttgatattgacaagtgggatgaccccaattttaaccctttttcttccacctcaaaaatgcaggagtctcccaaactgccccaacaatcatacaactttgacccagacacctgtgatgagtccgttgacccctttaagacatcctctaagacccccagctcaccttctaaatccccagcctcctttgagatcccagccagtgctatggaagccaatggagtggacggggatgggctaaacaagcccgccaagaagaagaagacgcccctaaagactgacacatttagggtgaaaaagtcgccaaaacggtctcctctctctgatccaccttcccaggaccccaccccagctgctacaccagaaacaccaccagtgatctctgcggtggtccacgccacagatgaggaaaagctggcggtcaccaaccagaagtggacgtgcatgacagtggacctagaggctgacaaacaggactacccgcagccctcggacctgtccacctttgtaaacgagaccaaattcagttcacccactgaggagttggattacagaaactcctatgaaattgaatatatggagaaaattggctcctccttacctcaggacgacgatgccccgaagaagcaggccttgtaccttatgtttgacacttctcaggagagccctgtcaagtcatctcccgtccgcatgtcagagtccccgacgccgtgttcagggtcaagttttgaagagactgaagcccttgtgaacactgctgcgaaaaaccagcatcctgtcccacgaggactggcccctaaccaagagtcacacttgcaggtgccagagaaatcctcccagaaggagctggaggccatgggcttgggcaccccttcagaagcgattgaaattagagaggctgctcacccaacagacgtctccatctccaaaacagccttgtactcccgcatcgggaccgctgaggtggagaaacctgcaggccttctgttccagcagcccgacctggactctgccctccagatcgccagagcagagatcataaccaaggagagagaggtctcagaatggaaagataaatatgaagaaagcaggcgggaagtgatggaaatgaggaaaatagtggccgagtatgagaagaccatcgctcagatgatagaggacgaacagagagagaagtcagtctcccaccagacggtgcagcagctggttctggagaaggagcaagccctggccgacctgaactccgtggagaagtctctggccgacctcttcagaagatatgagaagatgaaggaggtcctagaaggcttccgcaagaatgaagaggtgttgaagagatgtgcgcaggagtacctgtcccgggtgaagaaggaggagcagaggtaccaggccctgaaggtgcacgcggaggagaaactggacagggccaatgctgagattgctcaggttcgaggcaaggcccagcaggagcaagccgcccaccaggccagcctgcggaaggagcagctgcgagtggacgccctggaaaggacgctggagcagaagaataaagaaatagaagaactcaccaagatttgtgacgaactgattgccaaaatggggaaaagctaactctgaaccgaatgttttggacttaactgttgcgtgcaatatgaccgtcggcacactgctgttcctccagttccatggacaggttctgttttcactttttcgtatgcactactgtatttcctttctaaataaaattgatttgattgtatgcagtactaaggagactatcagaatttcttgctattggtttgcattttcctagtataattcatagcaagttgacctcagagttcctgtatcagggagattgtctgattctctaataaaagacacattgctgaccttggccttgccctttgtacacaagttcccagggtgagcagcttttggatttaatatgaacatgtacagcgtgcatagggactcttgccttaaggagtgtaaacttgatctgcatttgctgatttgtttttaaaaaaacaagaaatgcatgtttcaaataaaattctctattgtaaataaaattttttctttggatcttggcaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]