2025-07-01 09:22:53, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_015894708 585 bp mRNA linear INV 14-MAR-2016 DEFINITION PREDICTED: Acropora digitifera C-type lectin domain family 17, member A-like (LOC107330065), mRNA. ACCESSION XM_015894708 VERSION XM_015894708.1 DBLINK BioProject: PRJNA314803 KEYWORDS RefSeq; includes ab initio. SOURCE Acropora digitifera ORGANISM Acropora digitifera Eukaryota; Metazoa; Cnidaria; Anthozoa; Hexacorallia; Scleractinia; Astrocoeniina; Acroporidae; Acropora. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_015442571.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Acropora digitifera Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 10% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..585 /organism="Acropora digitifera" /mol_type="mRNA" /db_xref="taxon:70779" /chromosome="Unknown" /geo_loc_name="Japan:Okinawa, Kunigami, Oku" gene 1..585 /gene="LOC107330065" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 91% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:107330065" CDS 118..585 /gene="LOC107330065" /codon_start=1 /product="C-type lectin domain family 17, member A-like" /protein_id="XP_015750194.1" /db_xref="GeneID:107330065" /translation="
MAPPGLSWCVLILVVLVSECYSSDGEKACSCYTFENRERRDAFSWPRAREWCESNNKSLVVMETIEEWEFINSSLKDQIGNALKEWHIGLVINLTTGNWSWINGKPLTFDKWQPYKPGQSDLYVLIAKEFPTGSFGSFNSIRGGLTTIIQGDRGE"
misc_feature 202..>480 /gene="LOC107330065" /note="C-type lectin (CTL) or carbohydrate-recognition domain (CRD); Region: CLECT; smart00034" /db_xref="CDD:214480" ORIGIN
cctcagtcacgccttttcaaggcggaattgtcatgaatgcaggtcatttggtaaccacttcggtcagttgttttacggccacaacttgaaagaaagaaccttaccacgaatcaacgaatggctccgccaggactatcatggtgtgttctcattttggtggttttagtatctgagtgctattcttcggatggagagaaagcctgctcatgctacacatttgagaatcgtgagaggagagacgcattttcatggccacgagcaagagagtggtgtgaatctaacaataaatcgcttgttgtcatggagacaatagaagagtgggagttcatcaacagcagcttgaaggatcaaataggaaatgctttaaaggaatggcacataggactggtgataaacctaactactggcaattggagttggatcaatggcaaacctttgacttttgataaatggcaaccttacaaaccaggtcaaagtgacctttatgttctgattgcaaaagagtttcccactggttcctttggatcctttaacagcataagaggtggtttaactacgattatacagggagaccgtggagagtaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]