GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-06-02 00:30:56, GGRNA.v2 : RefSeq release 200 (May, 2020)

LOCUS       XM_015865349            4462 bp    mRNA    linear   VRT 18-FEB-2020
DEFINITION  PREDICTED: Coturnix japonica NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X1,
            mRNA.
ACCESSION   XM_015865349
VERSION     XM_015865349.2
DBLINK      BioProject: PRJNA314147
KEYWORDS    RefSeq.
SOURCE      Coturnix japonica (Japanese quail)
  ORGANISM  Coturnix japonica
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Perdicinae; Coturnix.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_029520.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Feb 18, 2020 this sequence version replaced XM_015865349.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Coturnix japonica Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4462
                     /organism="Coturnix japonica"
                     /mol_type="mRNA"
                     /isolate="7356"
                     /db_xref="taxon:93934"
                     /chromosome="5"
                     /sex="male"
                     /tissue_type="blood"
                     /country="France: Tours, INRA PEAT"
     gene            1..4462
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 8 ESTs, 4 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 52 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:107315227"
     CDS             454..3933
                     /gene="NRDE2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2 isoform X1"
                     /protein_id="XP_015720835.1"
                     /db_xref="GeneID:107315227"
                     /translation="
MALFPAFAGAPEPGEAPAGSSEGSRRELDWLSNPSFSTEDALLLHQRTTEAANLAPEKSPLVRSTSRSGLSGESDTDESLKKSSKKRKKKKKKHHHYKTKKKAKGDSSSSESDLDTKHIKDKAAANLDDKTSNLTSNRFVWLDDVKAFTEETFRIDKKSDPSNWAYKSLYRGDIARYKRRGESCLGIDAKKQCIAWDNPTSEKKQLQKRPERYFSKSNVKTLNIDGIPVCNRSSPSDPAAFIPVFHAETSDPSDTTEVNPLGIYDPSTTEWLQGKGYKGEEHEPVNTQQAFQEPGINVNPILMAKVEEHNKKVRENPRDVQAWMNFVSFQDELMRGPSPYASTGEQEVRRKSLKLVLEKKLAILERAIESNPSNVELKLARLNVCTEFWESPAVIKEWQKLIFIHPNNPELWKKYLLFCQSQFSTFSVSKINSLYGKCLTTLAAVQDGSMVSHPPLPGTEEAMLAIFIQQCHFLRQAGHSEKAVSLFQALIDFTFFKPDSVKDLPTKGQVEFFEPFWDSGKPRIGEKGARGWRAWMHQQEKGGWVAVDNPDDDDEEEIDEDEEIKDKTRPKWHIWMDIEYSRESRHWLPWRPDKTKNQAEEDCEDPERQVLFDDLGPSLIQLSNPDIQRQLLYSFLQFLGVPCINKLFPPSLYIAMDENNIFDNVLSDEKPLTCIDTPLSGFSSIGHMDTMQRRRHHIGHRKDGEEFIQNVFHALSPLFSGKEKSNLSVCWLQYEISKVVQCIQTKKKKKLKAQGRKSKKLAKNLLKAPDNRNNLALWKLYAYLEWLLGNTDDARKVFDTALCTAGTGGLKSPQLCSLSLLYAQLEVELLQSLEGAVTSRAVHILTKLAESRPYAPYSGQVLSVSVLKARKTYEHALQDCLNKAPVSDQDRTSHSNQLVNLVGCYTVFQYLTVGIDAAELVCAQALEKLEAPHPQKRENAAETPSIQHSPTALEAVTLLRANLLRFHMKISVYPLNPLREALTEALKWFPSNQALWRAYIQSQRKSHSASKARRFFDGVTRSTNSLEPWLFAIQAEQMRKKLIENVQRADVGEVFSTIPETGLTNRIISLFEHATQSENGTHCPLLWRMYLNFLVSVGKIERSKGLFYKAIQNCPWAKVLYMDAVEYFPEQLQETLDLMTEKELRVRVPMEELDLLLEV"
     misc_feature    1375..2373
                     /gene="NRDE2"
                     /note="NRDE-2, necessary for RNA interference; Region:
                     NRDE-2; pfam08424"
                     /db_xref="CDD:285605"
ORIGIN      
tttatcccgtctcctttatggagggcttgctcattgatgctatttaacatggtgagcatctcctccggttagaaaacatataaatgcagactacgggaatagttattttcccctaagcctctgctaccgccatttgggatggactctctggccagacagacctgcagccagtgtttgctcccagcgtgctgcatgagggaaaacggggcggtgtggagggacagactctgtctgtgtatgcctcaaaccctgttcttccttatggacagagttcggatagtgcaggacatccgcagcaccgagcctaccagccctctgtaagcaacagccgtgctccggccgccattttgggtgccgtgcaggcggactacagctcccagcacgctcggcgccgcagcgccatcttgctccgcggggcacttcgggccggtagcaccgcggacgcgctgggacatggccttgttcccggctttcgccggcgccccagagcccggggaggccccggccggcagcagcgagggctccaggagagaattggactggcttagtaatccaagtttctctacggaagatgccctgttactgcatcagcgcactacagaagctgcaaatcttgcccctgaaaaatcaccactagtcaggagtacttcaagatcaggtttatcaggggaaagtgatacagatgaaagcctgaaaaagtcaagtaagaagaggaaaaagaaaaagaaaaagcatcaccactataagacaaaaaagaaagccaagggggactccagtagcagtgaatcagacctggacacaaagcacattaaggacaaagctgcagcaaatctagatgataaaacatcaaatcttaccagcaaccgctttgtttggctggatgatgtcaaggctttcacagaagaaactttcagaatagacaaaaaatcagacccttcaaactgggcctacaaatccctgtatcgaggggacattgcaaggtacaaaaggagaggagagtcctgtcttggcatagatgcaaagaagcagtgtatagcttgggacaacccaacatcagaaaagaagcaattgcagaagcgacctgagcgctacttctcaaagagcaatgtgaagactctgaacatagatgggattcctgtttgcaatagaagttctccatctgacccagctgcatttataccagttttccatgcggaaaccagtgatccttctgacacaacagaggtaaatcctcttgggatttatgatccatcaactacagagtggctacaaggaaaagggtacaaaggtgaagaacatgagcctgtaaatacgcagcaggcgtttcaagagcctgggataaatgttaaccccattctaatggcaaaagtggaagaacataataagaaagtcagagaaaacccaagagatgttcaggcttggatgaattttgtttcatttcaggatgaattaatgagaggacctagcccttatgccagtacgggagagcaggaagtaagaagaaaatcactgaagttagtcttggagaagaaactagctattttagagagggcaattgaaagcaatccaagtaacgttgagctgaaactcgccaggctgaacgtttgcacggaattctgggaatcaccagctgtgatcaaagaatggcagaagctgatcttcatacatcccaataatccagagctgtggaagaaatatctcctgttctgccaaagtcaattcagtaccttttctgtctcaaaaatcaatagcctctatggaaaatgtttgactaccctggcagctgtacaggatggcagcatggtatcacatcctccactgcctggcacagaagaagctatgcttgctatatttattcagcagtgccactttctgagacaagctggccactccgagaaggcagtgtctttgtttcaggctctgattgacttcactttctttaaacctgacagcgtaaaggatctgccaacaaagggacaggtggaattctttgagcccttttgggatagtggaaaaccacgaattggagaaaaaggagcaagaggctggagagcatggatgcaccaacaagaaaagggtggctgggttgctgttgacaatcctgatgatgatgatgaagaagagatagatgaggatgaagaaataaaggataaaactcgccccaagtggcacatttggatggatattgaatattctcgtgaatcaagacattggttaccttggaggccagacaaaaccaaaaatcaagcagaagaagactgtgaagatccagaaagacaggtattatttgatgatcttgggccatctttaatccagctttctaatccagacattcagcgtcaattactgtattcatttttgcaattcctgggggttccatgtataaataaactctttcctcccagcctctatattgccatggatgaaaataatatctttgacaatgtgctttctgatgaaaagccactgacttgtattgatacgccactctctggattcagcagtattggtcacatggacacaatgcaaaggaggagacatcatataggccaccgtaaagatggagaggagttcatacagaatgtttttcatgctctatccccactgttttcaggaaaggaaaaatcaaacctgtccgtttgttggttacagtatgaaatatcgaaggtagttcagtgtatccaaacaaaaaagaagaagaagctgaaagctcaagggaggaaaagtaaaaaattggccaagaatctccttaaagcacctgacaacagaaataaccttgctctctggaaactctacgcctacctggaatggctgcttggtaacactgatgatgctaggaaggtgtttgacacagccctttgcacagcagggacaggaggactgaagagcccccagctgtgcagcctcagtctgctttatgctcagctggaagtggagctactgcaaagtctagaaggagctgttacctcacgtgctgtgcatatattgaccaaattggctgaaagcagaccatacgcaccctacagtggacaagtgttatctgtcagtgtcttgaaagctcgtaagacatacgagcatgcactgcaagattgtttaaataaagcaccggtttctgatcaggaccggacaagtcattctaatcaactggttaacttagttggctgttacacagtgttccagtatttgactgtcggaattgatgctgcagaattagtgtgtgcgcaggctttagaaaagcttgaagctcctcatccacagaaacgtgagaatgctgcagagactcccagcattcagcattctcccactgctctcgaggctgtcacactgctgcgtgccaatttactccgattccacatgaaaattagcgtttatcctttgaatcctttgcgagaagctctaacagaggccctcaaatggtttcctagcaaccaggctctatggagagcatacatccagagccagaggaagtctcacagtgctagcaaggcacgaaggttttttgatggtgtcacaaggtccactaactccttagagccgtggctgtttgccatccaagcagagcagatgagaaaaaaacttattgagaatgtccagagggcagatgttggggaagtattttctactattcctgaaactgggttaacaaataggattatctctctatttgaacacgcgactcagagtgaaaatggcacccactgcccattgctgtggagaatgtatctgaactttctggtttcagttggaaaaatagaaagaagtaaaggattgttttataaagccattcagaactgtccttgggcaaaggtactgtacatggacgcagtggagtactttcctgagcagctgcaggagacacttgatctcatgactgaaaaagaactaagagtgcgggtacctatggaagagctggatctactactggaggtttagaagaagataaggatgaagaaaatacaaagccagttctaaaactaacccctacaactcccttcaaacaagaacctgttgtgacttgagcactgacttcctcccctaagaacacatccgctcactgaagcagcgctggcttccacaggacaccctcttacaaacacagtcatgttgaacactgcccacatttcttattgtactgtttgaagataaattccctggagttcagcagagattccatacatgctgactgtagtttggtggctacacaggacataaacacctgctccacgatcactctgctctcctccaactggcagatctgagtaatttctttcagcttggtatgagtgtatataagtaccaagctgtagcacgttacatctgttcacaaacagctggtaaaagccaaatcttgtcttcaacagacacccattatggacttgtactgggatgttttgataaatgtctgctttaatatgaatatttaggaaataaataccttaagttttttataattcaaatggaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]