LOCUS       XM_015775752            2033 bp    mRNA    linear   PLN 07-AUG-2018
DEFINITION  PREDICTED: Oryza sativa Japonica Group cystathionine gamma-synthase
            1, chloroplastic (LOC4332956), mRNA.
ACCESSION   XM_015775752
VERSION     XM_015775752.2
DBLINK      BioProject: PRJNA122
KEYWORDS    RefSeq; corrected model.
SOURCE      Oryza sativa Japonica Group (Japanese rice)
  ORGANISM  Oryza sativa Japonica Group
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP
            clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa.
REFERENCE   1
  AUTHORS   Ominato,K., Akita,H., Suzuki,A., Kijima,F., Yoshino,T., Yoshino,M.,
            Chiba,Y., Onouchi,H. and Naito,S.
  TITLE     Identification of a short highly conserved amino acid sequence as
            the functional region required for posttranscriptional
            autoregulation of the cystathionine gamma-synthase gene in
            Arabidopsis
  JOURNAL   J. Biol. Chem. 277 (39), 36380-36386 (2002)
   PUBMED   12121993
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_029258.1) and transcript sequence (AB246893.1) annotated using
            gene prediction method: Gnomon, supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Aug 7, 2018 this sequence version replaced XM_015775752.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Oryza sativa Japonica Group
                                           Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            assembly gap :: added 81 transcript bases to patch genome assembly
                            gap
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-264               AP014959.1         14854285-14854548   c
            265-345             AB246893.1         211-291
            346-457             AP014959.1         14853668-14853779   c
            458-561             AP014959.1         14853468-14853571   c
            562-635             AP014959.1         14853282-14853355   c
            636-804             AP014959.1         14852978-14853146   c
            805-864             AP014959.1         14852311-14852370   c
            865-1068            AP014959.1         14852017-14852220   c
            1069-1155           AP014959.1         14851856-14851942   c
            1156-1263           AP014959.1         14851487-14851594   c
            1264-1359           AP014959.1         14851288-14851383   c
            1360-1478           AP014959.1         14851087-14851205   c
            1479-2033           AP014959.1         14850451-14851005   c
FEATURES             Location/Qualifiers
     source          1..2033
                     /organism="Oryza sativa Japonica Group"
                     /mol_type="mRNA"
                     /cultivar="Nipponbare"
                     /db_xref="taxon:39947"
                     /chromosome="3"
     gene            1..2033
                     /gene="LOC4332956"
                     /note="The sequence of the model RefSeq transcript was
                     modified relative to its source genomic sequence to
                     represent the inferred CDS: added 81 bases not found in
                     genome assembly; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 5 mRNAs, 51 ESTs, 21
                     Proteins, and 98% coverage of the annotated genomic
                     feature by RNAseq alignments"
                     /db_xref="GeneID:4332956"
     CDS             55..1599
                     /gene="LOC4332956"
                     /note="The sequence of the model RefSeq protein was
                     modified relative to its source genomic sequence to
                     represent the inferred CDS: added 81 bases not found in
                     genome assembly"
                     /codon_start=1
                     /product="cystathionine gamma-synthase 1, chloroplastic"
                     /protein_id="XP_015631238.1"
                     /db_xref="GeneID:4332956"
                     /translation="

MATVSSLPSPAFLAADPAAALPSATILRFPPNFVRQLSTKARRNCSNIGVAQIVAAAWSDPARPASLPGGGAGGRRGASSRAAATPAAAAAASAAAEATAEVGAIPNAKLGQPSAAALAEQALLGSDASLAVHAGERLGRRIATDAITTPVVNTSAYWFNNSQELIDFKEGRHASFEYGRYGNPTTEALEKKMSALEKAESTVFVASGMYASVAMLSALVPAGGHVVTTTDCYRKTRIYMETELPKRGITMTVIRPADMDALQNALDNNNVSLFFTETPTNPFLRCIDIDLVSKMCHSKGALLCIDSTFASPINQKALTLGADLVIHSATKYIAGHNDVIGGCISGRDELVSKVRIYHHVVGGVLNPNAAYLILRGMKTLHLRVQCQNNTAMRMAQFLEEHPKIARVYYPGLPSHPEHHIAKSQMTGFGGVISFEVAGDFDATRRFIDSVKIPYHAPSFGGCESIIDQPAIMSYWDSKEQREIYGIKDNLIRFSIGVEDFEDLKNDVVQALDKI"

     misc_feature    487..1590
                     /gene="LOC4332956"
                     /note="Cystathionine gamma-synthase is a PLP dependent
                     enzyme and catalyzes the committed step of methionine
                     biosynthesis. This pathway is unique to microorganisms and
                     plants, rendering the enzyme an attractive target for the
                     development of antimicrobials and...; Region: CGS_like;
                     cd00614"
                     /db_xref="CDD:99738"
     misc_feature    order(511..522,526..531,586..588,592..594,670..675,
                     679..684,751..753,766..768,775..777,1042..1044,1066..1068,
                     1072..1074,1120..1122,1150..1152,1156..1161,1396..1398)
                     /gene="LOC4332956"
                     /note="homodimer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:99738"
     misc_feature    order(673..681,751..753,883..885,970..972,1036..1038,
                     1042..1047,1072..1074)
                     /gene="LOC4332956"
                     /note="substrate-cofactor binding pocket [active]"
                     /db_xref="CDD:99738"
     misc_feature    order(673..681,751..753,970..972,979..981,1036..1038,
                     1042..1047)
                     /gene="LOC4332956"
                     /note="pyridoxal 5'-phosphate binding site [chemical
                     binding]; other site"
                     /db_xref="CDD:99738"
     misc_feature    1045..1047
                     /gene="LOC4332956"
                     /note="catalytic residue [active]"
                     /db_xref="CDD:99738"
ORIGIN      

ccgcgacccgccgcgccgcccgcccaaaccctagccctcctcctcctcctcgccatggccaccgtctcctccctcccgtccccggcgttcctggccgccgacccggccgccgcgctcccctccgccaccatcctccgcttcccgccaaacttcgtccgccagctcagcaccaaggcccgccgcaactgcagcaacatcggcgtcgcgcagatcgtcgccgccgcctggtccgaccccgcgcgccccgcctccctccccggcggcggcgccggcggccgtcgcggcgcctcctcccgcgccgccgccacgcccgccgccgccgccgccgcctccgcggcggcggaggccacggccgaggttggcgccatccccaacgccaagctcggccagccgtccgccgccgcattggccgagcaggccctgctcggttcagacgccagcctcgccgtccacgcgggcgagaggctgggcagaaggatcgccacagacgcgatcaccacgccagtagtgaacacctcggcctactggttcaacaactcgcaggagctcattgacttcaaggaggggaggcatgctagcttcgagtatgggaggtatggtaacccgaccactgaggcattggagaagaagatgagtgcactggagaaagccgagtccactgtctttgtggcatccgggatgtatgcaagtgtggctatgctcagcgcgcttgttccagcaggtgggcacgttgtgaccaccactgattgttaccgcaagacgagaatttacatggagactgaactacctaagaggggaattacgatgaccgttattagacctgctgacatggatgctctccaaaatgcactggataataataatgtatccctattcttcaccgagactcctactaatccatttctgagatgcatcgacattgatcttgtctcaaaaatgtgccatagcaagggagcattgctttgtattgatagtacctttgcatccccaatcaatcagaaggcactaactctaggtgctgacttagttatccattcagcaacaaagtacattgctgggcacaatgatgttattggaggctgcatcagtggcagagatgagctagtttccaaagtccgcatctatcaccatgtagttggtggtgttctaaatccgaatgctgcctacttgattcttcgaggcatgaagacactgcatctccgtgtacaatgtcagaataatactgcaatgcggatggcccaatttttagaggaacatccaaagattgcacgtgtctactatcctggtctgccaagtcacccagaacatcacattgccaagagtcagatgaccggctttggtggtgtcattagttttgaggttgctggagactttgatgctactaggagatttattgattctgttaagataccctatcatgccccatcatttgggggctgtgagagcattattgatcagcctgccatcatgtcttactgggattcaaaggagcagagagaaatctatggaatcaaggacaacttgatcaggttcagcattggagtggaggattttgaggatttgaagaatgacgttgttcaggcgcttgacaagatctaagcacctgattgcatcctcatcatgagagttcatctatctgatcttgtttgcctctgcatcacgtggagaactttgatattccagctgagaattgcgaataagtttcttcattagttcccattatctagtctttagttccaattaagtttgtgtctctgttttttcctctcaaaatggctatgttcagaattatttttgaaatgctgaaaatccaccgttgtgttgtgtacttttgcttgcctgttgtcctgttggtagtcggaacagagaagttgctttgcataccgttgggatgcattataccagtagttttattacggtttgagccttgctattgctgacatagatcactatgggtatgggatgtatggattcaatgagaacaaagcccaatctccattgcaagggtgaaaggatgctggggcttgatatca

//