GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-12-06 00:10:35, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XM_015649166            6165 bp    mRNA    linear   VRT 17-APR-2020
DEFINITION  PREDICTED: Parus major protein argonaute-1 (LOC107214130),
            transcript variant X2, mRNA.
ACCESSION   XM_015649166
VERSION     XM_015649166.3
DBLINK      BioProject: PRJNA312399
KEYWORDS    RefSeq.
SOURCE      Parus major (Great Tit)
  ORGANISM  Parus major
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Paridae; Parus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_031791.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Apr 17, 2020 this sequence version replaced XM_015649166.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Parus major Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6165
                     /organism="Parus major"
                     /mol_type="mRNA"
                     /isolate="Abel"
                     /db_xref="taxon:9157"
                     /chromosome="23"
                     /sex="male"
                     /tissue_type="blood"
                     /dev_stage="4 year old"
     gene            1..6165
                     /gene="LOC107214130"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 12 ESTs, 3 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 25 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:107214130"
     CDS             101..2419
                     /gene="LOC107214130"
                     /codon_start=1
                     /product="protein argonaute-1 isoform X1"
                     /protein_id="XP_015504652.1"
                     /db_xref="GeneID:107214130"
                     /translation="
MVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWMAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDRRSREGIKLPGGGSRFSFLRCNTRDS"
     misc_feature    <101..367
                     /gene="LOC107214130"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    398..547
                     /gene="LOC107214130"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    548..910
                     /gene="LOC107214130"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(704..706,749..751,791..793,803..805,857..859,
                     878..880,884..886)
                     /gene="LOC107214130"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1043..2320
                     /gene="LOC107214130"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1454..1456,1466..1468,1502..1513,1520..1522,
                     1544..1546,1553..1555,1565..1567,1577..1579)
                     /gene="LOC107214130"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(1658..1660,1664..1666,1874..1876,2288..2290)
                     /gene="LOC107214130"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
ctttgaagtggacattcccaagatcgatgtgtatcattatgaagtggatatcaaacccgataaatgtccacgcagagtcaacagggaagtcgtggagtacatggtgcagcacttcaaaccacagatctttggtgaccgaaaaccagtctatgatgggaagaagaacatctatactgtcacggccttacccattgggaatgagcgggttgactttgaggtgacaatcccaggggaaggcaaggacaggatatttaaggtctctatcaaatggatggccattgtgagctggcgcatgctgcatgaggccctggtcagcgggcagatccctgttccactggagtccgtccaggcactggatgttgccatgaggcacctggcttccatgaggtacactcctgtcggccgctccttcttctccccccctgaaggctactaccaccccctgggagggggcagggaggtctggtttggcttccaccagtcagtccggcctgccatgtggaagatgatgctcaacattgatgtgtcggccactgccttctacaaagcccagcctgtcatcgagttcatgtgtgaggtgctggacatccggaacatcgatgagcagcccaagcccctgacggactcacagagagtgcgtttcaccaaggagatcaaaggtctgaaggtggaggtgacccactgtgggcagatgaagaggaaataccgtgtgtgtaacgttacccgacggccagccagccaccagacgttcccgctgcagctggagagtggtcagacagtggagtgcacagtggctcagtacttcaagcagaaatacaacctgcagctgaaataccctcacctgccctgtctccaggttggccaggaacagaaacacacgtaccttcccttggaggtatgtaacatcgtggcaggccagcggtgcatcaagaagctcacggataatcaaacgtcaaccatgataaaagcaacagccaggtctgccccagacagacaggaggaaatcagtcgcctgatgaagaatgccagctacaacctggatccatacattcaggagtttgggatcaaggtgaaggatgatatgactgaggtgacagggcgggtcctgcctgctcccatcctgcagtatggaggccggaaccgggccattgcaactcccaaccagggcgtgtgggacatgcgagggaagcagttctacaacggcattgagatcaaagtctgggccattgcctgctttgccccgcagaagcagtgtcgagaggaggtgctgaagaacttcacagaccagctgcgcaagatctccaaggatgctgggatgccgatccagggccagccctgcttctgcaagtatgcccagggtgcagacagcgtggagcccatgttccgacacctcaagaacacctattcagggcttcagctcatcattgtcatcctgccagggaagacgcctgtgtatgccgaagtgaagcgtgttggggacactctcctgggaatggccacgcagtgcgtccaggtcaagaatgtggtgaaaacctccccacagactctttccaacctctgcctcaagatcaacgtcaagcttggcgggatcaacaacatccttgtgcctcaccaacgctctgctgtctttcagcagccggtgatcttccttggggctgatgtcactcacccaccagcaggagatgggaagaaaccctccataactgctgttgtgggcagcatggacgcccacccgagccggtactgtgccacggtacgtgtgcagcgtcctcgccaagagatcattgaggatttgtcctacatggtgagggagctcctcatccagttctataaatccacacgcttcaaacccaccaggatcatcttctatcgcgatggtgttcctgaggggcagctcccacagatccttcactatgagctcctggcaatccgagatgcctgcatcaaactggagaaggattaccagcctggcatcacctacatcgttgtccagaagaggcatcacacccggctcttctgtgcagacaagaatgagaggattggaaagagtgggaacatcccagcaggaacaacagtggataccaacatcacccatccctttgagtttgacttctacctgtgcagtcatgcaggcattcagggcacgagccggccgtcccactactacgtgctctgggatgacaaccggttcacggcagacgagctgcagatcctcacgtaccagctgtgccatacctacgtgcgctgcacccgctccgtctccatcccagccccagcctattacgcccggctggtggcgttccgggcacggtaccatctcgtggataaggagcacgacaggcgttcaagggaagggataaaactcccaggaggcggaagcaggttttcatttttaagatgcaatactagagactcctgactgtgaactggcggctttggtcctccgttgcccaccaggcgctggtaggtatttttgtgggtgttggggggaggggatttttagagccttaaaacagaagactagatttataaaactaatattttagattatgagatgctttaatgggttgaggggaaaagaaaaaaaacaaacaactagtttataggagaagtgtaacactaacagttccccgcccccgagtaattccccctggataatgtaaggcaccctagcacttagctcagaactgaaaactgtcttcctcgtgttacaagctagtcacctgctgccgctcgaagcaacagtcacagacttttccatgggtgagtgccttactatgatgctgcaaaatttcaatgtttttaatcttgtaaggaaactagtaatcttgtcttgatggtggtccatatttccatcggaaggagttaatttctatggtcctcagttgcagtttgtgtcagatcatgacctcacagtggttaaaccccattgaaagatgtgcactttcatacaggacacgtttaatggctgctgacccatttttgtttccaatgtattacttgttatttaaaactgtttctgacaaatgggggcatctcaatcccatgaggacagaaagcgctatccatgttttttctttaggttttttcccccctgaatttttatgatggacaccgggattttttactaaacattatttttatacgatattgagtctgttgccaaaatccacaagtcattaacattctcaaagtttacatccccgcacttcctgaggctgtatgctcacaccacagctctccgtttctgtccaatgagtgctgccgactgcagcctgtgctgtgccaggtgctccacagtgctcgttgcccgtgtgcattcggcatgtgtctgcccaggcctgctttcccacctaccatatctccaccttcagcaccccaggctctcaccctctctgctgctaggttttgctgatctttgtgtcatggtatcactgctctcatgcccagggtttttattctgaaagcacaccagattgttccttagaatgatgaaatccctgttgttgttatgggggaaactcctgatttgtccttgtaccaggaaaacagccttttcccccacaggaacctggtcactgcttttcagacccattttgctgcacagtgaccgtacgcacggtggcgggaccgtggtggcagctcagtaccagtatcatccgggcacattatctggggttttttctatgaaagtgttcacagcacttccttcaagagacaaatgaggcgcacgctcctgccacgctctgaggggaagagctctggtatcattttcctgctgaacgcatttcccaggcggccccacacaagcgctacccctggcccatgcgcagacagaagcacatgaaaacctctttgatttgtactttctgacgttgaaacttgccttgccttcatgaaaaccacaccggtcatgttggcccactgagctgtcctaaccctgggaattcactctttccattttcttttggggcaacgtgtctgtgaacagtgacaacatcactatgctatgcaaactaagtgctgagtccactgatgtcacgtttggtgaagattctgcgtttagcacagtcctgttttcctcaagaccacagtgtttggttcatatcctcctttgcaccttgtgtcaacctccactgctgtatacccccaaggtgacggggaggagaccaggaaccatccgtggtcagtaggtagggaactcttaaggaaggcttagagcatagggaacacatcaacacttaagtgtcaacatgagaagcctacattcctctacacaagtgcctgcatagtgacaccaatcagcacctccatctcatcctccgaactctggcttgtgttcactgaaagcaaaacaatctcagaggggctgttcccgctcacctggtgttagaaggctcctccttatgaataaaatcggggtcaaggtcaaggttctctctgcaaatcagtttgttcaccagcattacaccggaacgcacctggctgctgctctgcagtgaggggcaaaggtatttaggttccttgtttttattttagtgttttagttgggtctagaattctgaaatgtcttttagtagctgtggcatagcacgtgccatttttaaccatttgaaaagagatagtgtgggcatttacagaaacagcttgttgctctgtaacaatttttttttaaccttgagacttgaaatgtaaaatggacctttaagatttgcactcatttgtaaggtggctgttcatagaaaactatgaatgaagacttgctgatgtagcacctacttttaacagcaattttaactacacaaaagcttcacagcttctgaaactctcagctgttgacttgcagatcatgttctgaccttatttcaccctctgtgttgggttttcatggttttggataaacaaaaaagccaatctcagtagctgctgtgccctttaaaccctgtttccactttgaagaagtttagagaggttggagtgacctgcatgttttctatactagactatgcaccgtaccctctccgcgctccagcactggcatttctccccctctcttgtctgagatgaaaacaagtagctgcatgttgaggtgcgttttgctgcctgtagcggataggtgttaccccaggtacaaatcaggatctgtagttagccacaaaccccacacgggcatcccgatcagctccgagtgtctgccttctccatgcgcacgagttccacctgcgattggaagtgtcgctgagtgcatgcagttctgtgggaagaggagtagctttcatttacctgttgaatgctgtcgtttcccttatctcgtatctgaaaagaatggggcgggagggttgctctgccctctctccgaagcttccagggcagtcagggtgttcttggatcgcacatgatgtctcaaacagcccaagcatccagcattgcctcatggaaggttttcttcttggaaaatcagtgtgaaataaaagaatgtgattgtttcaggaagggaagccagacagcaggagagcaataaacaagtgaaattcgtttcttgcccaagtgatttgcacttcaatagttgtgaaagaaaatttccaggactccagtgcttttgtgttcgatttccagcccctttcgtacctcctttctatgagcaagtgtgggactgtacatagggtgtttacaggatgctccgtttgggttgttatttttcttgtgggttttttttgctctagcttgaactctgtatggtccatttgttaaatagccgtgaacagttgatgtacagtacttactaaacaagcagcagcacaaaatttattttattaagaaaatatggcttatattttaaaggttgaatatcatttttttttatttttttttggtatgtgtggaattaaggctggtgaagagtaacaaagtccttggattaggccaaaagaaaatactgtaagatcctaaccacctctttattaaagaaagcagtatgattaaagagctccagaacattgtatttatattggatttgatttaattgcatttgtggattattttttttgccttggtcctgatttttgcttgcaacttcaactttgcagtcccaagtgtctgttaccctgtaactgttggcagaagacctaaataaaagcaatgtgaatatgtttttattgacataaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]