GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 00:03:58, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XM_015629952            4254 bp    mRNA    linear   VRT 17-APR-2020
DEFINITION  PREDICTED: Parus major NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), mRNA.
ACCESSION   XM_015629952
VERSION     XM_015629952.3
DBLINK      BioProject: PRJNA312399
KEYWORDS    RefSeq.
SOURCE      Parus major (Great Tit)
  ORGANISM  Parus major
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Paridae; Parus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_031774.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Apr 17, 2020 this sequence version replaced XM_015629952.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Parus major Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4254
                     /organism="Parus major"
                     /mol_type="mRNA"
                     /isolate="Abel"
                     /db_xref="taxon:9157"
                     /chromosome="5"
                     /sex="male"
                     /tissue_type="blood"
                     /dev_stage="4 year old"
     gene            1..4254
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 7 ESTs, 3 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 35 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:107205521"
     CDS             54..3557
                     /gene="NRDE2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2"
                     /protein_id="XP_015485438.1"
                     /db_xref="GeneID:107205521"
                     /translation="
MALFPAFAGAAQPGEPPAGSSEGSTRELDWLSNPSFSAEDALLLHQRTTEVANLIPEKSPLIRTSSRSELSEESDTDESLKKTSKKRKKKKKKHHHKKTKKKTKGDSSSSESDVDTKHTKDKGSSKSSEKEAAANLGKKASNVTSSRSIWLDDIQAPTADTFRIDKKPDPANWAYKSLYRGDIARYKRKGESCLGMDAKKHCITWDSSASKRKQAQSRPERYFTKSNVKMLNTDGILVHNKNSPSDPPAFIPVSQVESDNSSDTAEVNPLGIYDSSTTMWLQGKGSKTADSESVNTRQTIEEPGINMNSVLMAKVEEYNKKVRENPRDVNAWMEFISFQDELMRGPSPYGSRGEQESRRKSLKLILEKKLAILERAIESNPSNVDLKLARLKLCAEFWEPPALIKEWQKLIFLHPNNPEMWKKYLLFCQSQFTTFSVSKINSLYGKCLTTLAAVQDGSMVSHPLLPGTEEAMLAIFIQQCHFLRQAGHSEKAVSLFQALIDFTFFKPDSVKDLPTRGQVEFFEPFWDSGEPRIGEKGARGWKAWMHQQEKGGWVVLKPDDEDDEDIDEDQEIKDKTLPKWHIWLDIEYSREARHWLPWRPDKTEKETEEDCEDPERQVLFDDLGPSLIRLSNPKLQHQLLYSFLQFLGVPCTSKLFPSSLYIAMDENNIFDSVLYDDKPLTSVDFPLSGFNSIGHMDTMSRGRHQIGHYKEGEEFIQNVFHVLSQIFTGKEKSNLAICLLQYEISKVIQCLQAKKKKKLKAQGRKSKKLAKNFLKAPDNRNNLSLWKLYAYLEWLLGNTDDSRKVFDTALGTAGTGGLKSAQLCSLSLLYAQLEVELLESTEGAVMSRAVHILTKLTENGPYVPYSGQVLPVNVLKARKTYEHALQDYLSKTPVSDQDQVKDTDQLVSLVGCYALFQYLTVGIDAAVLIYTQASEKLEASGSQKCENAGENFGILDFPTALEAVTLLHTNLLRFHMKISVYPLNPLREALTEALKRYPSNQSLWRSYIHIQRKSHSANKARRFFDSVTRSTNSLEPWLFAIQAEQMRKKLTEKVQRADVGEIHCTIPETGLTNRIVALFEHAVQSENGTHCPLLWRMYLKFMTSLGKKEKSKGLFYKALQNCPWAKVLYMDAVEYFPDDLQETLDLMTEKELRVRVPMEELDLLLEI"
     misc_feature    1002..1997
                     /gene="NRDE2"
                     /note="NRDE-2, necessary for RNA interference; Region:
                     NRDE-2; pfam08424"
                     /db_xref="CDD:285605"
ORIGIN      
gcggcgccatcttgccgtcggcagctcgggcggggggcggcggcggccgagacatggcgctgttcccggccttcgccggggccgcccagcccggggagccccccgccggcagctccgagggttccacgagagagttagactggcttagtaacccaagcttctctgcagaggacgcattattactgcaccagcgcactacagaagttgccaatctcattcctgaaaaatcaccattaataaggacttcttcaagatctgagttgtcagaggagagtgatacagatgagagtctgaaaaagacaagtaagaaaaggaaaaagaaaaagaaaaagcatcatcacaagaagacaaaaaagaaaaccaaaggagattccagtagcagcgaatcggatgtggacactaagcacaccaaggacaaaggaagtagcaaaagtagtgaaaaggaagcagcagcaaatctaggtaagaaggcatcaaatgttaccagcagtcgctctatctggcttgatgatatccaggcccccacagcagacaccttccgcatagacaagaaaccagaccctgcaaactgggcctacaaatccttgtatcgcggggacatagcaaggtataaaaggaaaggagagtcctgtcttggcatggatgcaaagaaacattgtataacttgggacagttctgcatcaaaacggaagcaagcacagagtcgacctgagcgctactttacaaagagcaatgtcaagatgctgaacacagatgggattcttgttcataataaaaattctccatctgatccacctgcttttataccagtttcccaagtggaatctgacaattcttctgacacagcagaagtaaatcctcttgggatttatgattcatcaaccacaatgtggctacaaggaaaagggtccaagactgcagacagtgagtctgtaaatacacggcaaacaattgaagagcctgggataaacatgaactctgttctaatggcaaaagtagaagaatataacaagaaagtcagagaaaacccaagagatgttaatgcttggatggagtttatttcctttcaggatgaattaatgagaggacctagcccttatggcagtaggggagagcaggaatcaaggagaaaatcactcaagttaatcttggaaaagaaactggccattttagagagggcaattgaaagcaatccaagtaatgttgatctgaaacttgccaggctgaagctttgcgcagaattctgggaaccaccagctttgatcaaagaatggcagaagctgatttttttacatcccaataatccagagatgtggaagaaataccttctgttctgtcaaagtcagtttactaccttttctgtttcaaagatcaacagtctctatggaaaatgtttgacaacactggcagctgtacaggatggcagcatggtatcccatcctctgctgcctggcacagaagaagctatgctggctatatttattcagcaatgtcactttctgagacaggctggccattctgagaaagcagtgtccttgtttcaggctctgattgacttcaccttctttaaacctgacagtgtaaaagatctgccaacaaggggacaggtggaattctttgaacccttttgggatagtggagaacctcgaattggagaaaaaggagcaagaggctggaaagcatggatgcaccaacaggaaaagggtggctgggttgttcttaagcctgatgatgaggatgatgaagacatagatgaggatcaagaaataaaagataaaactcttcccaagtggcatatttggttggatattgaatattcccgtgaggcaaggcactggttaccttggaggccagacaaaactgagaaggaaactgaagaagattgtgaagatccagaaagacaggtgttatttgatgatcttggaccatctttaatccgtctttctaatccaaagcttcaacatcaactattgtactcttttttgcaatttctgggagttccatgtacaagtaaactctttccttctagtctctatattgccatggatgaaaataacatctttgacagtgtgctttatgatgataagccgctgacttcagttgattttccactttctggattcaacagtattggtcatatggatacaatgtcgagaggcagacatcagataggccactataaagaaggagaggagttcatacagaatgtcttccatgttctgtcccagatatttacaggaaaggaaaaatctaacctggctatttgtttgctacagtatgaaatatctaaggtaattcaatgtctccaagcaaaaaagaaaaagaagctaaaagcacaagggaggaagagtaagaagttggccaaaaatttccttaaagcacctgacaaccgaaacaacctttctctctggaaactctatgcctacctagaatggctgcttggtaacacagatgattccaggaaggtgtttgacacagctcttggcacagcagggacaggaggattgaagagtgcccagctctgcagcctcagcctgctctacgctcagctggaagtggaactgctagaaagtacagaaggagctgttatgtcacgtgctgttcatatattgaccaaattgactgagaatggaccatatgtgccctatagtggacaagtgttacctgtgaatgtcttgaaagctcgtaaaacatatgaacatgcacttcaagattatttaagtaaaacaccagtttctgatcaggatcaggtcaaggatactgatcagctggttagcctggttggttgttatgcactgttccagtatttgactgttgggattgatgctgcagtattaatatatacacaggcttcagaaaaacttgaagcttctggttcacagaaatgtgagaatgctggagagaattttggtatcctagattttcccactgctctcgaagctgtcacactgctgcatacaaatttactgagattccacatgaaaattagtgtttatcctttgaatcccctgcgagaggcactaacggaggctctgaaacggtatcctagcaaccagtctctttggaggtcatacatccacatccaaaggaagtctcacagcgcgaacaaagcacgaagattttttgatagtgtcacaaggtctactaactctttagagccatggttgtttgcaatccaagcagagcagatgagaaaaaaactcacagagaaggttcagagggcagatgttggtgaaatacactgcactattcctgaaactggattaacaaatcggattgtagctctatttgaacatgcagttcagagtgaaaatggtacccattgtccactgctatggagaatgtatttgaaatttatgacttcactaggaaaaaaagaaaaaagtaaaggattgttttataaagcccttcaaaactgtccttgggcaaaggtactctatatggacgcagtagagtatttccctgatgatctgcaagaaacgcttgatctaatgactgaaaaagaactgagagtgcgggtacctatggaagagctggatctactactagagatttaaaagaagactgtaatggagtggaggaagtacagaagctgcttccaaagctgacaataagatccatctctttttcatacagaactctgttgggacttgggtactatgtacttgatacttttttgttgttgttaaatctttttctttgttgttaaattcctatcaaaatggagttctactacctgcaagtgttctggaatcaagaactgcattttgcccacaataatggatccatttttctgaagtattgctggctcccacagaagcataccctctttaaatagcctcctgttggaagttgcctgcatttcttattctattgtttgaaattacattccctggggctcagaagaggttcagtacttgccaactatggcttggtgagcagcacaggaaataaacatatgccaaatggatgctccactgtcctccagttggcagacttcagtaatttccttcagcatggtatgcctgtgtatatgtaactgccaagtcagagccattacatctgtacatatactgtgagtaaaagctaaatttttgtttgagcaggcacctattttggtatgctttgacagattaccattttaatatatttttttctgaaaaatatacctgaatatttgaaaattcaaaagtaacttgttttttatttattaatagaactttaagtgtattaaaaatgaacacgtgtccataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]