GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 04:59:11, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_015245239           10270 bp    mRNA    linear   MAM 22-NOV-2019
DEFINITION  PREDICTED: Vicugna pacos argonaute RISC catalytic component 2
            (AGO2), mRNA.
ACCESSION   XM_015245239
VERSION     XM_015245239.2
DBLINK      BioProject: PRJNA221631
KEYWORDS    RefSeq.
SOURCE      Vicugna pacos (alpaca)
  ORGANISM  Vicugna pacos
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Cetartiodactyla; Tylopoda;
            Camelidae; Vicugna.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_021964206.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Nov 22, 2019 this sequence version replaced XM_015245239.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Vicugna pacos Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..10270
                     /organism="Vicugna pacos"
                     /mol_type="mRNA"
                     /isolate="Carlotta (AHFN-0088)"
                     /db_xref="taxon:30538"
                     /chromosome="25"
                     /map="unlocalized"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..10270
                     /gene="AGO2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 mRNAs, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     43 samples with support for all annotated introns"
                     /db_xref="GeneID:102530126"
     CDS             42..1994
                     /gene="AGO2"
                     /codon_start=1
                     /product="protein argonaute-2"
                     /protein_id="XP_015100725.1"
                     /db_xref="GeneID:102530126"
                     /translation="
MMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPPGTGRSLPSLPSWAAWTHTPIATAPLCGSSSTGRRSSRTWLPWCASCSSSSTSPRASSPPASSSTATASRRGSSSRFFTTSYWQSARHALSWRRTTSQGSRSSWSRRGITHGSSAPTRMSGLGKAETFQQAPPWTPKSPTRPSLTSTCVVMPASREQAGLPTITCFGMTIVSLPMSCRSSPTSCVTPMCAAHAPCPSRRQPTTLTWWPSGPGTTWWIKNMIVLKEAIPPGRVTDETIRPWQRLSRFIRTHCAPCTLLDMF"
     misc_feature    <42..83
                     /gene="AGO2"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    84..446
                     /gene="AGO2"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(240..242,285..287,327..329,339..341,393..395,
                     414..416,420..422)
                     /gene="AGO2"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    579..>1238
                     /gene="AGO2"
                     /note="Piwi-like: PIWI domain. Domain found in proteins
                     involved in RNA silencing. RNA silencing refers to a group
                     of related gene-silencing mechanisms mediated by short RNA
                     molecules, including siRNAs, miRNAs, and
                     heterochromatin-related guide RNAs. The...; Region:
                     Piwi-like; cl00628"
                     /db_xref="CDD:294420"
     misc_feature    order(990..992,1002..1004,1038..1049,1056..1058,
                     1080..1082,1089..1091,1101..1103,1113..1115)
                     /gene="AGO2"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:239208"
ORIGIN      
ggtttggcttccatcagtccgtccggccttctctttggaagatgatgctgaatattgacgtctcggcaacagcgttttacaaggcacaaccggtgattgagtttgtttgtgaagttttggattttaaaagtattgaagaacaacaaaaacctctgacagattcccaaagggtaaagtttaccaaagaaatcaaaggtctcaaggtggagataacgcactgcgggcagatgaagaggaagtaccgcgtctgcaacgtgacccggaggcctgccagccaccaaacgttcccgctgcagcaggagagcgggcagacggtggagtgcacagtggcccagtacttcaaggacaggcacaagctggtcctgcgctacccccacctcccatgtttacaagtcgggcaggagcagaaacacacctaccttcccctagaggtctgtaatatcgtggcgggacagagatgtattaaaaagctgacggacaatcagacctcaaccatgatcagagcgactgccaggtcagcccccgatcggcaggaggagattagcaaattgatgagaagtgccagttttaatacagacccgtatgttcgtgaatttggaatcatggtcaaagacgagatgacagatgtgaccgggcgggtcctccagccgccctccatcctctacgggggcaggaacaaagcgattgccacaccggtccagggcgtctgggacatgaggaacaagcagttccacacgggcatcgagatcaaggtgtgggccattgcatgcttcgccccccagcgccagtgcacggaggtccacttgaagtccttcacagagcagctcagaaagatctcgagggacgcgggcatgcccatccagggccagccgtgcttctgtaaatacgcccagggggccgatagcgtggagcccatgttccggcacctgaagaacacgtacgccggcctgcagctggtggtggtcatcctgcctggcaagacgcccgtctacgccgaggtcaagcgtgtgggagacacagtgctggggatggccacgcagtgtgtgcagatgaagaatgtgcagaggaccacaccacagaccctgtccaacctctgcttgaagatcaacgtcaaactgggaggcgtgaacaacatcctgctgccacaggggaggcctccagtgttccagcagccagtcatctttctgggggcggatgtcactcaccccccgccggggacgggaagaagccttccatcgctgccgtcgtgggcagcatggacgcacaccccaatcgctactgcgccactgtgcgggtccagcagcaccggcaggagatcatccaggacctggctgccatggtgcgcgagctgctcatccagttctacaagtccacgcgcttcaagcccacccgcatcatcttctaccgcgacggcgtctcggaggggcagttccagcaggttcttcaccacgagctactggcaatccgcgaggcatgcattaagctggagaaggactaccagccagggatcacgttcatcgtggtccagaagaggcatcacacacggctcttctgcaccgacaagaatgagcgggttgggaaaagcggaaacattccagcaggcaccaccgtggacaccaaaatcacccacccgaccgagtttgacttctacctgtgtagtcatgccggcatccagggaacaagcaggccttcccactatcacgtgctttgggatgacaatcgtttctcttccgatgagctgcagatcctcacctaccagctgtgtcacacctatgtgcgctgcacacgctccgtgtccatcccggcgccagcctactacgctcacctggtggccttccgggccaggtaccacctggtggataaagaacatgatagtgctgaaggaagccatacctccgggcagagtaacggacgagaccatcaggccttggcaaaggctgtccaggttcatcaggacacactgcgcaccatgtactttgcttgacatgttttagtgtttacgattgtgtaccgaggtggattcacacgagaccagctacactcagaccaacaaacgcccagccctagcgtgacagccagcactgaacacgagacgtcagtgatttagcagattctccgttttccagaatgccttccgtcccagatctcagacttgggttttgagctgcagacctgtatgagaccccactgtcgcaggaaatgtggtttgccaaaatctatgagctgcttattaaaatagagtcccgtgtttcctaaaaatctcctaaaaccagtctatgaactcagggctttaaaacatttttaatttatttggtcactcaacttacttgtttttaacacatgatcctgtatgaaattgatggactcaaactagctgtgaacgttctgagagtggaagcaacacagcacacaacgtggttttaaagccttgaccattctgatgtcgtcagtagggcttattgcagagtgacgccagtgcactcctgacgtgactggcgccagccctgcaggaccccaggcggggccgggctgaggcgcccgcggtctctcgttctgccattgcctgcttttccctcagctcccaggaaggcgccgtggcaggggatgggccgcgtgtgttcacaacagttacaggtccagagggattggcaggcaagtgccgttttaataacagtttatttaaaaaaagaagaaaaaagacaatatgccgacagtctaatcataagatttgtcctataggactgtgacatttattttccaaagtttctaaagaatacgggtctgtggtgataaatacagtacaatcctttttcactgttttgtctttaatgtaagagaaaaaatatatatatctggtttgcagtattaatgtgatagatagaagctgtttttcattttatcgactacggggtgcttcttgtgatctgttcagcatatcaagagtgtttcggagcctggagactggaccacctcttgtggttctcagtgcttaagtacaggagtatgcaattgactaaatgtgaccgcggcctgccccctcagtgcagactggaccctcgggagggccgggtgtgcccccagcagtcaccccccttccctcctccgcatcccgtgggttgctcagccgatcaagcacaagtggaaagcgtttcttcttccattcctgggaacgagttggtgtgtcccggtgcacttctctgcgcgtggtctgttagacaggcgtcataggatctgtgcactgaggcacacaggcggccggcggtgctggcgctctgctggatgcgaggctggcaatcagcgacggagccctgcccccgggaggacggctgagggcgaagccagcaggagaggcagacccttctgctaggatttgcgtcctgggccctggacgtgggtttgccaatctagaaaccattgcactaagagtgacaccgtggacagctcgccgggggagcagcggagcgccattggtgctcggtgggtttctcatcctcgtaggcagttttattaagaatcaaatcgcattcaatacagagattcgagcaaggagacgagcctttccctagtgctgctttgtgctctgcaggccaccttgggccctgctgacggcccccctttctggcctgccgttgacctctggcgcccagtgctgtgtgtgaggctccgaggggcgcgggtagagctgtagtgggtgctcagcctggactttggtggcagcgacaaagggatgactatgacttgtgaagatatatactcagagtagtgtgtgcgtgtgtgtgtgtgtgtgcgcgtgcgcacatgtgggtgtcacattaatggcattagtctcttcttgctgtatctttttattttttgtctttttaaatgacagaagcctctgctctaaaaaatgttgcaattccctgttgttttattagcaagtggcactttctcccgttcagaatgatcccagtgcactcttggcgtaaattaccaggaacattcaagctaaggggggactcttttcactaataaacttttaaaatctgaaattaggttaattttcagccatttaggaccatctagaactgtgtgtctcagaggggtgtttctgccatttgcaggaggatcttggtcgtcggcgcagtggtggtgaaaaggcagcgcccctgcggccctccctgcgcagacgctccaggcctggggctgcctgtcagtgggagctccggggctgagcagctccaacctggcggcttctggaggccccggggtgggggctccccggcagttcagggagaggttttctaacctcacaccctggggtggatcttgggctggctggaaattagaccaaaatttttttaaaaatcagtttgaaggaaagttttctttctagtgggccgaagtactttgagaaaggtacatcttacagccctctgcttgttttgtaaagcttttcctacttaaaaacgttaataaaccaaacgtctccagcagggttggctgcacaccctcatacgtgtctgatggtcagaattcaaatggctgtaattacagtttctcaggtaaataattgttttcctagatttctaccaatccccccattattaggataaattttgagacagcattaaacctcagagtgcagcagagtagttccaagccctgtccatctggaagccaaaggggaccctgcccattctgattgtgttgtgcccagggcggcctggtgaccacgtggccggcctgagaggggcccagggacgtcggcctctgcctgtgtttggcgggtttcctgaggcccgtgtggggcctcgccgatttcaggggcctccgcttgctggctttgccccaccccactgttaagtaaggtgtgccttgctttaattaagcaaactgaatgtgaagattatgatgtagaaaagctggattcatttaaaagaaaaactgggatttatctcatctctttgtaagaggcctcccaattcagttcttatcctgggactctccctggtgtattttaaaacattcactgtaagaaaagttaacgtcttccggtcccttccgcactgtctgttccattggccaagctcttggcaagtagctcggtgatgagacgccccaggtggggggtcgccctgctccttgtgttctgatcacaagctcagacttcctcgttcacgtagatcgtgtaaagctgggcatccctgtacttgcagaaaggggtggctttattttggttttggttttctgttttgagagaaacatatacacttggcttctggtcgtggtctcactctcccgtgagtgaatgcctgtgaaccacggcccggcctggcccacccggaggggctgtcggtgctggagtgatccccacgccgttcgcgggcggccatgcctggcgctgtccctgacgattgtgccgcgagtgctcactagaagagacagttgaagttcagttcctacagcagggtttttggggggtgggtgtcgctggtgtgttgtgtgttgtttttattgttgtaaatggagatgtcgctatttatttttcctttctgctctggtttgatttagctggtgtggatagtccagtgcatgtggtacctgatggagatgatagaaattactttccccaacttttataaattacctgatgtttgtttcccttcaggtttgctggatgatttatttttgaaagccgcaaatgcggtttctcggggtgagttgtttttcttacacgtgcagcagtgtaacttcacactgagctgcagggtgatttaaattttatttttacaaggcagttttccagtcagattatatatttgatacaacgcgttaagggcagaccagccacgcactgagcagctggggccgcagactgtctcgaggaggccgggccggctgctctcggccacgccccgtcgcggaagcccttggccggcttccggagccgtcggcatcgggatgcgtcctgcagcgggacttggacctgctggacagttgaaggacttttcctgggcatttcctgcacctaaggcagctccattgggaggagctttagaagttgacacgatccagacagtggacaatcccagtggcccagacaagccatagaagttttcccctgtgacctctctctaactcacctctcgcgctcccgagaaaaggaatgtacagtaaacagaaacttcctcaacgtccacgcgcctcactttcagaatgcaactgttctatttgtattttcagcccttccccagagtaacccagaatgttctctccagctgccgtgccagcagtttcggctgctgtgacgttttcagtgtagacgtaacgctcatgtgactttgtcatggggctgtccgtgttacacacacatgctgactctttttgtaaggaaaaatttcaactcaaaataattgcactgattttttgacaacttcctttttattatgtccgactttgcatctgctgtacttgtttgaaatgattgtaaatagacttaggatagcagaaatgatgtgaatacgccccattgctttgttttagtggtattgccccatttttcagtattatgtgctagcgctgtgtggactgacttctgccccccctccccccagccgtgtgcctgtgaccgctgatgaaggacaagctggcctcgttgtcttctcgtcctggaggggagtttgcagtctgttggaaggagaggatgccctctccttgcggtctgaagacttaattctaagaggattaactctaaacccttttgctctgtttaattccttgtcatttgccgtgactccttaaagcgtttgcctccggctccatccagcatttgacagctcggaggggaagcatctgaagggccacatttcccaagagtcagggcctcccttctctttgctccgccgtcatctcaaagccatgaggtcactgttgtgtcagaaccgtcgtttgtggcttaacccagaggtgctgggcaggcctgaaatccagtgctgttcctttgtgccctgtgatttgccagactagaagcgttgctccagcccacagcgtctaattctgtttgtggtcgggctgctgggacctcttaaacccaaaccagtcatctgagtatgtattatatgtcacgtccatgccattctcggtgccctcacttaacgcttttttggatgttttgccgttttattgtctaaagtgaatgtattggcttagccatatcactacagaaggtggttattaaataccttttagttaaaaaaaatgcagataaaggctacctctgaattctcaatagactcatgcttttaagcgtagctgtccaccctgcaaacagccaaaatgttgcctgaataaactgaattgtgagcatctctctgttcggttctggcttgaccatttgtgtgccatactgtgacccacgggcagtcccctccccaatgtgtgtcaggaccagaccagggactcctctgggctgcccagctccgagagtctaggactctcagtgccagcgggactggagccgggggccatttctgcgccgacctcaggtgtgaggccttgtacggcgaaacctggaaatgacccgcagtcctcctggcttcttactttcctgtttgacgtaagaaggcatttttttttctgctttccttttgaaagggttgaaggtggctccctccactctctcctccattttcgtgcgctctgtaaaatcacgaaggtgcttgcacgccgactcccacgcagacagtgcccttacagtactgcgtggtttcagatgcagggcagacgtcagtgcccttgacttgggagctttgagttactgtcactccgtactttaaaacgataagatttgaaagcagaatgttctgttccaatccaaggcccttggtttgaaaggagcacagggtccacggcggcgtctcgaagtaggcgtgccctctgcctgcgtgctgggcatctgtcctggcggggggttgtctcacgtgtgattaaccactttgctgtcaggaatgtcctttgcccgcacgctgctgtgggccggtcaggctcaccctctgcctcctccacgtctttccttaggttccatgtgttctcttgtcgtcacaaggtgagtgtctgctgcaaaatcacctgcactggttgcttctgagttcttgaggggcaggtgagcagcgttgcacttgcagacacctgggtgtgccctggcagctttgctcccctccagatgctcagccaaccttgactttgtcccagcgaggttccagttgcaccgtacatggaagtcattgcctttaacgctgttgttttcatgctgcgtggagtggtttagtcccaaaagtgcttagtgtcctttgcagtttttctaaaaatgtgtcgttctgcggtcacgctgttgtgcagatgcaggcgcccccagcatctgctgactgctcccagggctactggggtctctgaagcagttcgtttccagccagaatcccatacagggttttccggggggcgctgcacgtggccacctcctctccagcaatgtgaaccgctgagctcaggtctgcccgtcagcctgttgtatgcacgaggtgggcctccgccactgtctttgtgttcctgcaagatcattaaaggtgaggaaactgaaggttactggtgcttttgtgaacacttcgctgtcttactggtcgatgtgagaaactgaggtgtggtaggtctttcagtgcccttggtgggcggcaggggggctgacgggccctgacgccttcttcaggcagttcgaagaggctgaattttctcctatgtacaaactccttggatttcagtagttcagagttaaagctggcacaccaaatactggcttttctcccctcccctcccctccccatctccaggagctccttgtggaggccagtcccatcagtactgtcggcacctgcatcccgagttgatcgcagttgcgccccacaccacgagtccgggctgcgtggcaccgcctggcagagctcgatgctagtgaggggcccgaggctcctttgatctctggctatggtagggacaatccccagggtgggactgctggccctctgacctaagaaacagttggcgcccaggcctcctccggtccccgtcggtgccggactgagtgtgcccagagacccaagctcagcctctgtgccttccagtcgggtcctgggggtccttcagcatcacgatggggctgcgtttttactgggaaggaagcctgttctgttccacagtcagtccctgacaccccccgcctttgaagctgcttctgctccttggctcccagcattgtaaactgtgaggccagcacgttatctctggctggaaggctctgggtctcagctgcctaactcccctggcccggagctgctggggcttcaggaaggcagggcagggcccacctctcggtcagaccacgaaccttgtgctcatgatcacctggcgtgagtatttagtggcactagattttttaagagatgaattggaattggaatcatgtctttatagaatgcatgtgaagtcctagatgaaggtgctatttcagccctccgtctgtcatggcggagtgcttctcctcactgtggctgttttgtgatgtgcggggaaactgctcccttgggcatggtgtcacctagagccagttccaaggtgtctaaagcgcagcttttagctctgactttttcaaaacaggaaccaagcagttttcttggctgatgatctgattaaaccctccttccctctcagtggatgatcttactggttttaagtggggaaaataacccaacattatttactttaaagtgtatagaaaagccttgttggtggctgctccaggcaccgccctctccccagccctccattccgacggggctgcacagagacactggccacaggcaggctggagagtaacgattttggtccttccttcaaagccaaatgtacacaggactgagatcctggatgtctgtagtttagcactaaactgaaatctgactcctgagtttgatagtggattttaaatgtagttgttgaaggtataaattcatgttttgtaactgtagaggcaagtgagtttttactttttaaaaagttttaagggaataattgtaagtttctgtgcagcaaagtggctaattactcattaaatacaagaaaagaatgtagtgtctaaatccagatttttcttacctctggtacacttcagattgcttacctaatatgtattgaggggtttcaaccctgagttttatcaacttttctagttttattttat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]