GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-15 04:44:30, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_014658111            2601 bp    mRNA    linear   PLN 12-OCT-2017
DEFINITION  PREDICTED: Vigna radiata var. radiata protein NETWORKED 4B
            (LOC106772009), mRNA.
ACCESSION   XM_014658111
VERSION     XM_014658111.2
DBLINK      BioProject: PRJNA301363
KEYWORDS    RefSeq.
SOURCE      Vigna radiata var. radiata (mung bean)
  ORGANISM  Vigna radiata var. radiata
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50
            kb inversion clade; NPAAA clade; indigoferoid/millettioid clade;
            Phaseoleae; Vigna.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_028358.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Oct 12, 2017 this sequence version replaced XM_014658111.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Vigna radiata Annotation Release 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2601
                     /organism="Vigna radiata var. radiata"
                     /mol_type="mRNA"
                     /variety="radiata"
                     /cultivar="VC1973A"
                     /db_xref="taxon:3916"
                     /chromosome="8"
                     /tissue_type="leaf"
     gene            1..2601
                     /gene="LOC106772009"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 9 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:106772009"
     CDS             694..2427
                     /gene="LOC106772009"
                     /codon_start=1
                     /product="protein NETWORKED 4B"
                     /protein_id="XP_014513597.1"
                     /db_xref="GeneID:106772009"
                     /translation="
MMKNQPSQWWWLESHSNTRRSPWLQSTLTELNEKTKAILKLIEEDADSFAQRAEMYYKKRPQLVSMVEDFYRTHRSLAERYDQIAGIRQQKTGGSPFSPLKHHQPEKLMSFANDSYDSCSESCDVEESGESEIDDPEPEEEEDSKFDNCAELKEVQFVAANDVMEIERLGEENKDHKDQNKQKYNIYEVVMLREEIEQLRKENRVQKDELNRKSITFDELMMLREEIEQLRKENRAQKDELYQKDIICGEAMMLREEIEQLGKENRVLKDELSQKSIICGEVMILREEIEQFRKENRAQKHELNQKDIICGEAMMSREEIEQLSKENTVLKDELNQKNIICDEVMMLREEIEQLRKENREQKDELNQKDNICGEIMMLREEIEQLGKENGALKDELNKKYIICGEIMMLREEIEQLRKYNRGQRNELDQKGNKCEVTMLREEIEVYTKENRVKNDELNPEDSVCGEVVMLRKEIERLGKDERAQKGTLSGEVMKLRQENSAQKDHLKQKDQEKIEVIRHLSLAIDMLKQENVKMRSFIAKESANKWKNPFGFKNFMGSLSEQLFNGITKNQPSIVAL"
     misc_feature    718..939
                     /gene="LOC106772009"
                     /note="KIP1-like protein; Region: KIP1; pfam07765"
                     /db_xref="CDD:429647"
     misc_feature    1141..>2001
                     /gene="LOC106772009"
                     /note="chromosome segregation protein SMC, common
                     bacterial type; Region: SMC_prok_B; TIGR02168"
                     /db_xref="CDD:274008"
     misc_feature    1732..>2298
                     /gene="LOC106772009"
                     /note="Septal ring factor EnvC, activator of murein
                     hydrolases AmiA and AmiB [Cell cycle control, cell
                     division, chromosome partitioning]; Region: EnvC; COG4942"
                     /db_xref="CDD:443969"
ORIGIN      
aaaagttaaataagccattaaaaaaaaaataattactagtcaaacaaattttattgccaccactcaaaatgaaacagccacccaacacagtgtccccacaaactgatctgtcactagaaaatgcgtttattttgaattagtatatagtttgggttcgaccgttgcactaaaatttttgtcttcacatcacgctcctccgattttccatctaagtcacacgccagatactgcttttgccaaatcagaattatcgctaatcaccaatttaaataattaatacatcatttaagcatagttattgcattactgaagcactaatttttctcataatcttcgtgcttttcaatttaaaccttccatagattatggcagcgggatcattgactgaactgtagcattttgaatttgagtgtgtttatatgaattattactatgattggtcggacgaggcaaagggttgattgtgatatgttgagtacacgtgtggtatgatgataggtggagggtttcagatgagacaaatcaagaatttcaaaaccgaaaacaacagtatatataaaatggtcctgttctaatctcttgctcttcgtgaactctaattctaattccatcgcaggcggtggtggcaagcattgcattaattcatgctcttggtgttcgtgataacatagacaactgaggaggagggctaaaatgatgaagaatcaaccgtcacagtggtggtggcttgagagccacagtaacacaagacgatccccttggcttcaatccactctcacagagctaaatgagaagacaaaggcaatcttaaaactaattgaagaagatgcagattcctttgcccaacgtgctgagatgtattacaagaagagaccacagcttgtgagcatggttgaagacttttataggacacatcgatcattagctgagcggtatgatcaaatcgctggaattcgtcagcagaagactggaggatcacccttttctccactcaagcatcatcaaccagagaagttgatgagttttgcaaatgacagttatgatagctgttctgagagttgtgatgtggaggagtctggggaatctgaaattgatgatcctgagccagaagaggaagaggattctaaattcgataactgtgcagaactgaaggaagttcagtttgtggctgcaaatgatgtgatggaaattgagagacttggtgaagagaacaaggatcataaggatcagaacaagcagaaatataacatttacgaagtagtgatgttgagggaagaaatagagcaactcagaaaagagaacagggttcagaaggatgaactcaaccggaaaagcatcacttttgatgaattaatgatgctgagggaagaaatagagcaactaagaaaagagaatagagcgcagaaggatgaactctaccagaaagatatcatttgtggtgaagcaatgatgttgagggaagaaatagagcaactcggtaaagagaatagagttctgaaggatgaactaagccagaaaagtatcatttgtggtgaagtaatgatattgagggaagaaatagagcaatttagaaaagagaatagagcgcagaagcatgaactcaaccagaaagatatcatttgtggtgaagcaatgatgtcgagggaagaaatagaacaactcagtaaagagaatacagttctgaaggatgaactaaaccagaaaaatatcatttgtgatgaagttatgatgttgagggaagaaatagaacaactcagaaaagagaatagagagcagaaggatgaactcaaccagaaagacaacatttgcggtgaaataatgatgttgagggaagaaatagaacaattgggaaaagagaatggagcgctgaaggatgaactcaacaagaaatatatcatttgtggagaaataatgatgttgagggaagaaatagaacaactcaggaaatataatagagggcagaggaatgaactcgaccagaaaggtaacaagtgtgaagtaacgatgttgagggaagaaattgaagtatacacaaaagagaatagagtgaagaatgatgaactaaacccagaagatagcgtttgtggtgaagtagtgatgttaaggaaagaaatagaacgacttggaaaagatgaaagagcacaaaaaggtaccctttctggtgaagtaatgaagttaaggcaagagaatagcgcgcagaaggaccaccttaagcaaaaagaccaagagaaaatagaggtgataagacacctgagtttagctatagatatgctgaagcaggagaacgtaaagatgagaagcttcattgctaaggaatcagccaacaaatggaagaatccatttgggtttaagaatttcatgggatcattatcagagcagttgtttaatggaattacgaagaatcaacctagtattgtagctctctagataaggttcacagagtaaatagctaagttttgtagagcaatattaaaagagacctatgtacatgttatggggacctgctcaagtaacctacagatcttgtatacagcttagtatattcctaactaatccaagaccgagtatctagtggatttcctatacacttgtttttctaca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]