GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-12-06 00:25:26, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XM_011419586            5852 bp    mRNA    linear   INV 18-MAY-2020
DEFINITION  PREDICTED: Crassostrea gigas protein argonaute-2 (LOC105321320),
            transcript variant X5, mRNA.
ACCESSION   XM_011419586
VERSION     XM_011419586.3
DBLINK      BioProject: PRJNA629593
KEYWORDS    RefSeq.
SOURCE      Crassostrea gigas (Pacific oyster)
  ORGANISM  Crassostrea gigas
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Bivalvia;
            Pteriomorphia; Ostreoida; Ostreoidea; Ostreidae; Crassostrea.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_047559.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On May 18, 2020 this sequence version replaced XM_011419586.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Crassostrea gigas Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5852
                     /organism="Crassostrea gigas"
                     /mol_type="mRNA"
                     /db_xref="taxon:29159"
                     /linkage_group="1"
     gene            1..5852
                     /gene="LOC105321320"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 66 long SRA reads, 2 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 179 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:105321320"
     CDS             130..2784
                     /gene="LOC105321320"
                     /codon_start=1
                     /product="protein argonaute-2 isoform X5"
                     /protein_id="XP_011417888.1"
                     /db_xref="GeneID:105321320"
                     /translation="
MFPIAPGSTFGPFTTVPPPEPPPHPADQPPPTPPPPSNGNAGEFICPLRPDHGREGKPIALRANHFHVNIPKGFIHHYNVAITPDKCPRRVNREIVETMVNAYTPRIFSGQKPVFDGREKLYSREPLPFGKDKVELEVTLPGEGRDRVFKVAIKWLSQISLYALEEALEGRARRIPECAVEALDVIMRHLPSMMYTPVGRSFFSPPEDYDYPLGGGREVWFGFHQSVRPSHWKMMLNIDVSATAFYKAQPVIDFMCEILELKDANEQRRPLTDSQRVKFTKEIRNLKVEITHCGTMRRKYRVCNVTRRPAQTQSFPLQLDSGQTVDCTVARYFLERYKMKLQHPHLPCLQVGQEHKHTYLPLEVCNVVGGQRCIKKLTDLQTATMIRATAKNAPDREKEINNLVKKASYNNDPHLRTFGITVNPQMMDLHGRVLSHPKLQYGGTNSEFQTKAQALPNQGVWDMRGKQFYFGIEIRVWAIACFAPQRSVREDALRNFTQQLQKISTDAGMPILGQPCFCKYATGPDQVEPMFRYLKNTYAGLQLIVVVLPGRTPVYAEVKRVGDILFGLATQCVQSKNVNKTSPQTLSNLCLKINVKLGGINNILLPSSRPLVFREPVIFLGADVTHPPAGDTSKPSIAAVVGSMDAHPSRYSATVRVQEHRKEVIEEFCSMVRELLISFYKSTQFKPTRIIIYRDGVSEGQFQKVLAHELRAVREACMKLEIGYQPGITFIAVQKRHHTRLFCADRKDQIGRSGNIPAGTIVDVGITHPTQFDFYLCSHAGIQGTSRPSHYHVLWDDNCFKADELQQLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVEKEHDSGEGSRHSDEMERTPSAMARAITVHPDTIKVMYFA"
     misc_feature    274..2637
                     /gene="LOC105321320"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    274..690
                     /gene="LOC105321320"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    721..870
                     /gene="LOC105321320"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    871..1233
                     /gene="LOC105321320"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1027..1029,1072..1074,1114..1116,1126..1128,
                     1180..1182,1201..1203,1207..1209)
                     /gene="LOC105321320"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1366..2658
                     /gene="LOC105321320"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1792..1794,1804..1806,1840..1851,1858..1860,
                     1882..1884,1891..1893,1903..1905,1915..1917)
                     /gene="LOC105321320"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(1996..1998,2002..2004,2212..2214,2626..2628)
                     /gene="LOC105321320"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
tcagaattttttggggtgattagtgtaacgtcaatcgtgcgccatattttcttttgacaaaagatgaaaatgacagaagtttgtttacctctcctgatttaccattttccctcgtcataagatgtcataatgtttcctattgcaccagggtccacctttggtccttttaccacagtccccccaccagaacctccaccccacccagctgatcagccaccccccacccctccacctccatctaatgggaatgccggggagtttatctgccccctcaggcctgaccatggacgggagggaaaacccattgctctacgggccaaccattttcatgtcaacatccctaaagggttcatccaccactacaacgtcgccattacacctgacaaatgtccccgacgagtcaacagagagatcgtggagaccatggttaatgcctacacaccccggatcttctccggacagaagcctgtgtttgatggcagagagaaactgtacagtcgagaaccacttccattcggcaaagataaagtggagttagaggtcaccctgccaggtgaaggtcgtgaccgggtgttcaaggtcgccattaagtggctgtcccagatcagtctatacgccctggaggaggcgttagaggggcgtgcccggaggattccagagtgtgcggtggaggcgctggacgtcatcatgaggcacctccccagcatgatgtacacccctgtgggtcgttcattcttctctcccccggaggactatgactaccccctgggagggggcagggaggtgtggttcggcttccatcagagcgtccgtccctcccactggaaaatgatgctcaacattgatgtatcggccacagccttctataaagctcaaccggttatcgacttcatgtgtgaaatcttggagctgaaggacgccaacgaacagcgacgcccactgaccgattcccagcgggtcaagttcaccaaggaaatcagaaacctgaaggtagaaatcacccactgtggaaccatgaggaggaaatatagagtttgtaacgtcactcgcagacccgcacaaactcagtcatttccgctacagctggactcgggtcagacagtggactgtacggtcgctcggtacttcctggagcgctacaaaatgaagctacaacaccctcacctgccgtgtttacaagttggacaggaacataagcacacatatcttccattagaggtttgtaatgtcgttggaggccagagatgtatcaagaagctgacagacctacagacggccaccatgatcagggcgacagccaagaacgcccccgacagagagaaggaaatcaacaatctggtcaagaaggccagttataacaatgacccccacctgaggacgtttggaatcacagtaaacccccagatgatggatctacacggccgggtcctctctcaccccaaactacagtacgggggaacgaattcggaatttcagacgaaagcccaggccctgccgaaccagggcgtgtgggacatgcgagggaagcagttctattttgggatcgagatccgtgtgtgggccatagcatgcttcgccccccagaggagcgtgagggaggatgcattgaggaactttacccagcagttacagaagatttctacggacgcaggcatgcccattcttggtcagccgtgtttctgtaagtatgccactgggcctgaccaagtggagcccatgttccgttacctgaagaatacgtatgcggggctacaactgattgtggtggtcttacctggacggactccagtgtatgcggaggtgaagcgtgtgggagacatcctgtttggtctggccacccagtgtgtacagtccaagaacgtgaacaagacctcgccccagacgctgtctaacctgtgtctgaagatcaacgtcaagctgggcggcatcaacaacatcctgctacccagctccagacccctggtgttccgtgagccggtcatctttctgggagctgatgtgacccaccccccggctggagataccagcaaaccctccatagccgccgtggtggggagtatggacgcccatcccagccgttactcagcgacggtgagggtacaggagcaccgtaaggaggtgatagaagagttctgctccatggtcagggaactcctgatctccttctacaagtccacccagttcaaaccgacccgcatcatcatctacagggacggggtcagcgagggacagttccaaaaggtgcttgcccatgaactgagagcggtgagggaggcctgtatgaagctagagattggttaccagccgggaatcaccttcattgccgtccagaagaggcaccacaccaggctcttctgtgccgaccgcaaggaccagataggacgtagcgggaacatcccagcgggaaccattgtggatgtcggaatcacccaccccacacagtttgacttttacctatgcagccatgccggtatacagggcaccagcagaccctcccattaccacgtgttgtgggacgacaattgtttcaaggcggacgagctccagcagttgacataccagctgtgtcacacgtacgtacgctgtacgcgtagcgtgtccatccctgctcctgcgtactacgctcacctggtggcatttagagcgaggtatcaccttgtggagaaagagcatgacagcggagaagggagccgtcactcagatgagatggagaggacaccctcggcaatggctcgagccatcaccgtccaccccgacaccatcaaagttatgtacttcgcttagaccacgaaacaattacctgatcttaggaaatgatttaactcaccagatattggcaacctgccaaaaaccagctcacccaaactttacaaagtgctcccacggaacagtctagtcatccaccacagcgtcgacgattcgtgtttattcatgtgtacgacgatgtcttatcgcacatttctacttttatttttgttaataaactgtccctatcaatgcatgagtgagcaattgttaaatataaatgtatttgttttttttgaaaaaatgatatgaataatattagagtgtaattactagagaacactattaatttggaacagtgtatttttctagaactgtgaagttttgtccattttgagttggttttcttacttgtagcaaatttttgaactggtggtgattatttgaggccatcatactatttttcaaaatgttttccattgacttatcggggtcaagtgctgttttttggagatggtttataggggtttggtgtctgatgcatgcatgttatggtctctgaacacctgtcagtgttgacacttgatatttaaagggtgttgtattgtagtcttgaacaacatggtcttttttttaaaatgatcattcgaacaataaggtgtatctttttgtattttgtaaagaattcattaatgcatgatttttcgcaataagtgtgatgttacattgggtgttgggaatgtttcagtccgagttttgcatctggggaaattacaatgcatattcaagaactgtgaaatattgacaacaattagttcatctttcaaactgaatctcataatttcaaggtcaaagtaccaaaatttatcaatattttgatcccattggagtcttcataatagagttagagcagctgttcaatattaagattatactttttatacaccatatttgatcctctatgtaacacattttaacaccggactgagtgtataaagatgttatatatattagaattgttcatatcatgtcattttgtgtgatgtacactgttttaccaagcagaagccgggaatctgttattatgtatttacactgcatcatttcaagataagttcatgttagaatggcagtagaatttttgtctattttaatcttacactcagtatatagtcttgttattcgctgtagaatcattcaatttgtgggctgtaattttcatggattgcttgttccaagaatgtagtcaaacattaattttatgaaattctttaaaattaatttggttgttcctatccacagaatccatgaattctggattaaggtttccacaacattcatggatttgtggattttggaacccacactattgataaatttgtaaataaatgtatccagaagtaaatgaactttgacccacaaaagtaatgagaccacagtactagcattggatagtcacagactagataaattgtaccctgtatcttaattaaatgattccttgtaattcttcctttgattagccccagaatcaatgtaaataatactaaagtatgttcaattgtgggtgttattgtcaaacatttgatgtcagtactccatcatagcaggacgtgacaaggttaagtcaaacagatcatgacccagtgtttacacctgtacaggtaatggaatagtgtgaaagtaccttccacatctggccagtagttgagagaaggtcaaggtcaggctatactggagtcaaggtcacaaaccaaatgatggcgttttctttgtatgtgcatatataaagcaatggaagaaaggctgtggacaacttttactttgtactgtattattctgtggtgtctctgtagtcagttttacttttagttatttacatcatgtgcagtgaactttgaactcttgttgttataaacaatatattttgttatgataaaaaatttcaaagcaaaacaaaaaaaatacatttctgaccttgtgtaatgcattgataaggaaaagtccttgcagcaattctgaatgatagaattatgtagacatggccctatgaagttaataataggggaggatgatagaattatcccattcactgtgtacacatgtatgctcaacatagtgctcccaaacagctaactatgcaggtccattatacgtatacagagaagctatggacatgtcattacttatctcacaatactgacaaaagctatgggcaggttcattacacataacagaaaaactatgggcaagtccattacacaactatggacaaatccattacacattttagaaaaccttttggaaggtcagatgctaattaccataactatgggcaggtcctcttcacatagcagaaaccattggcaggtccattacccaaaaaaatgtaggggcaggcccattacaccacacaggaaaaattatgggcatgtcatcacagaaaaaatagctatgagcagacacactgcacatcatggagaaactatgagcaggtccattacacatcatggagaaactatgagcaaagccatatgaaaatggattttaaacatggctcacagtgactagaaattgatttattacatcatttcacaacaaactttatcttaaggttcataaagtgtatgggcagctaattgttaataaataagtactttagtagggaaattctcatgttattcatctgatgaaaattgcacaacagcagtttttgtgaatgctgttaagaattggaagtattgcaacttactgttaacacaacagatgtaaaattttgatggcacaatattatgaaatttattaaaacctgatctttctgtaaaactatgtacagtgcttctcagttaatgtttctgttgtgtaaggatgtcatattattattcgacaaatgagataatcatgttataattttggatcatctgactttgagatcacagtggtttatagaatgaatatcatttttagaaatttacaaatgcatgaactttattcatatcctatatctatattgaatatgttgtcctttatctgttaacttctttgtttttatctgttataattgtagatttacagcttaaatttaacaaaataaattgtctttgata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]