GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-12-05 23:26:09, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XM_011240521            7442 bp    mRNA    linear   ROD 24-JUN-2020
DEFINITION  PREDICTED: Mus musculus argonaute RISC catalytic subunit 1 (Ago1),
            transcript variant X2, mRNA.
ACCESSION   XM_011240521
VERSION     XM_011240521.2
DBLINK      BioProject: PRJNA169
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000070.6) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Aug 8, 2019 this sequence version replaced XM_011240521.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Mus musculus Updated Annotation
                                           Release 108.20200622
            Annotation Version          :: 108.20200622
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..7442
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6J"
                     /db_xref="taxon:10090"
                     /chromosome="4"
     gene            1..7442
                     /gene="Ago1"
                     /gene_synonym="Eif2c1"
                     /note="argonaute RISC catalytic subunit 1; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 2 mRNAs, 25 ESTs, 668 long SRA reads, 3 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 23 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:236511"
                     /db_xref="MGI:MGI:2446630"
     CDS             822..2951
                     /gene="Ago1"
                     /gene_synonym="Eif2c1"
                     /codon_start=1
                     /product="protein argonaute-1 isoform X2"
                     /protein_id="XP_011238823.1"
                     /db_xref="GeneID:236511"
                     /db_xref="MGI:MGI:2446630"
                     /translation="
MPHRVGACARGTSSLPVPARYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRVSRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHISGQSNGRDPQALAKAVQVHQDTLRTMYFA"
     misc_feature    894..1040
                     /gene="Ago1"
                     /gene_synonym="Eif2c1"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:337161"
     misc_feature    1041..1403
                     /gene="Ago1"
                     /gene_synonym="Eif2c1"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1197..1199,1242..1244,1284..1286,1296..1298,
                     1350..1352,1371..1373,1377..1379)
                     /gene="Ago1"
                     /gene_synonym="Eif2c1"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1536..2822
                     /gene="Ago1"
                     /gene_synonym="Eif2c1"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1956..1958,1968..1970,2004..2015,2022..2024,
                     2046..2048,2055..2057,2067..2069,2079..2081)
                     /gene="Ago1"
                     /gene_synonym="Eif2c1"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(2160..2162,2166..2168,2376..2378,2790..2792)
                     /gene="Ago1"
                     /gene_synonym="Eif2c1"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
gcctttgttgccgtcgagcgccccgcttgactcgttcccgtccgccccatgggcccatcggtcgcgcctgcgcactggcagctactcgggcgctagcagggggagctgctgcaggctccgcggcggcggcaacggaggctgcgggggcgacagcgcgagcggccgggcttcgggggggagccgagcccggcccgggagcccgagcagtgcaagtgcgaggtacctaggcccctcacgctggactcctcagtctcccggccgcctgtcctccgcacgggtatatgggatggaagcgggaccctcgggagcagcggcaggtgcctacctgcctcccctgcagcaggtgtttcaggcaccccgccggcctggcattggcactgtgggcaaaccaatcaagcttctggccaattactttgaggtggacattcctaagattgacgtttaccattacgaggtggacatcaagccggataagtgtcctcgcagagtcaaccgggaggtggtggaatacatggtccagcatttcaaaccgcagatctttggggatcgcaagcctgtgtatgatggaaagaagaatatttacacggtcacagcactgcccattggcaatgagagggttgactttgaggtgacaatccccggggaggggaaggatagaatttttaaggtctccatcaagtggctagccattgtgagctggcgcatgctgcatgaagccttggtcagtggccagatccctgtgcccctggagtctgtgcaagccctggatgtggccatgaggcacctggcatctatgaggccagggctcctccgtgcccaggatgcctcacagggtgggggcctgtgcccgagggaccagttctctgcctgtccctgccaggtacacccctgtgggccgctccttcttctcaccgcctgagggctactaccacccgctggggggtgggcgcgaggtctggttcggctttcaccagtctgtgcgccctgccatgtggaagatgatgctcaacattgatgtctcagccactgccttctacaaagcacagccagtgattgagttcatgtgtgaggtcctggacatcaggaacatagacgaacaacccaagcccctcacggattcccagcgtgttcggtttaccaaggagataaaaggcctgaaggtggaagtgacccactgtggacagatgaagaggaaataccgcgtgtgtaatgttacccgccgccctgctagccatcagacgttccccttgcagctggagagtggacagactgtggagtgcactgtggcacagtatttcaagcagaaatataaccttcagctcaagtatcctcacctgccctgcctacaagttgggcaagaacagaagcatacctatttgcccctcgaggtctgtaacattgtggctgggcagcggtgcattaagaagctgactgacaaccagacttcaaccatgataaaggctacagctaggtcggccccagacagacaggaggagatcagccgcctgatgaagaatgctagctacaacctggatccctacatccaggaatttggaatcaaagtgaaggatgacatgacggaggtgacaggacgtgtgctgccggcgcccatcttgcagtatggcggccgggtgagcaggaaccgggccattgctacgcccaaccaaggtgtctgggacatgcgcgggaaacagttctacaatgggattgagatcaaagtctgggccatcgcctgcttcgcaccccagaaacagtgtcgagaagaggtgctcaagaacttcacagaccagcttcggaagatttccaaggatgcagggatgcccatccagggtcagccatgcttctgcaaatacgcacagggggcagacagcgtggagcccatgttccggcatctcaagaacacctactcaggactgcagctcattatcgtcatcctgcccgggaagacgccagtgtatgctgaagtgaaacgtgtcggagatacactcttgggaatggcaacacagtgtgtgcaggtgaagaatgtggtcaagacgtcaccgcagactctgtccaacctctgcctcaagatcaatgtcaaactcggtggcattaacaacatcctagtcccacaccagcgctctgctgtttttcaacagccagtgattttcctgggagcagatgttacacatcccccagctggggatgggaagaaaccatctatcacagcagtggtaggcagcatggacgcacaccccagccgatactgtgccaccgtgcgtgtgcagcgcccacggcaggagatcattgaagacttgtcctatatggtgcgcgagctgcttatccagttctacaagtccacccgcttcaagcccacccgcatcatcttctaccgcgacggcgtccccgagggccagctgccccagattcttcactatgagctgcttgccattcgagatgcatgcatcaaactggaaaaagactaccagcctgggatcacatatattgtggtgcagaagcgccatcacacccgcctgttctgtgctgacaagaatgagcggattgggaagagtggtaacatcccagcagggaccactgtggacaccaacatcacccacccatttgagttcgacttctatctgtgcagccatgcaggcatccagggtaccagccgaccatcccattattatgtcctttgggatgacaaccgtttcacagcagatgaactccagatcttgacataccagctgtgccacacttacgtacgatgcacacgttctgtctctatcccagcacctgcctactatgctcgcttggtggctttccgggcacgataccacctggtggacaaggaacatgacagtggagaggggagccacatatcagggcaaagcaatgggcgagacccccaggccctggccaaagctgtgcaggttcaccaggatactctacgcaccatgtacttcgcttgaaggcagaacgctgttacctcactggatagaagaaagctttccaagccctgggagctgtaccacccaaatccagaggaagcaaggcagagggaggtggggtcggaaggagtataggaggccttgtttctatctacagagggggtataagggtgggaagaggaccagcaagacagactaccagccagaaatcactgatagcaacctcattgtcctcaacccctctccccatcttgtcatatccgacccccttggaccaaaaggggcatcactagtacccaccatacacacagttgtctcatgtgactcacagtgctaaagactcatgctcaacagcctgctagggtcagctctgcagccctgtggtcaaatgctggtatgtttgggtttgctattctagatgagaaagtgggtgggaagagggcaggaatttttaggagccttaatcagaaaaggtctagatttgtttaagaaaaaggaaaacagactcagatcaatattttaggatactagatgttttcatgggttcagaatccactttgtaggaagatttttaatgctaatggtttgggttgctcctccccagctgccatcccctcccatcattcctctccacattctctaccccatgcaccttttccctgacagacatccagccctcgtaacacttaaggcactatggcacttagctctgaggtgacatgaccctgtcttccttccgcctgctggtgggtaaccagtgccttcccgcaacggtaatgctgcagaactgcaaccttttgtacctttctctgtggggtggggtgtgggtgggaaaggagggagggagggagggcagaaatagcccaatgccagcgagcctccagccagaatgccagctaattttcatttgaaggaattgacttccataatcattgagcttttaaaaaaaggtcacaacctcaagatggttaaaatccattgacatttgcactttcagacgtgacaagtctccgagctgctgagatgactggcccttggcctttcccctttagcttcctcttttccctggccccaccaccaccctgccagatctagagttactgtcatagtatttctcattcttggcttttttacccctgatggtaaagtctcgtttcaatatttcttaactggggtgtcttacagcagaagatcgtaaggactaaaataagaaaacaaaaaatctaaaggttatttttataccataacttgagtctattgccaaaatctggaaattccctcccatacctgatgagtctgcattccagaaacatggagccgtaagagggaactgtggaactgacttgtgttctggcctagctaagtagggggtggttgtctccccaaggtggggctcagcctctgtccttcctctgtgcagacaaagccttgttctcgagacagcctccctccagggcgctgtcctgccctcttccctgtaagtgcatcttccccttttctggactggactgtcctttgatccctgactaaccgagactctagcacgtcctctggacaggctggggaattttgctgctcccatttgcttctgtttacacaaatgaaattttcctgtttctcactagggcatgtgagtgggtggcatgggcttttctttttctacccctctcttgaggttctggggttcagctagctgtcttgcaggactggaaaagaagtgggttctagctttgtctttgctgaccttgaagcaaggccccctctttccttgaccattcttttttcttcctgcattattgcttgggatgggaaatttgaacctccgtgtacaggttccccttctgaggagcctgagcttaggattgccctactctggcgatgaagccatgatatgttagctctagcccaggcttagaggcccgctggagaaaggaagatctgaaccctggcctatggagtcaaaacctttccccaagagcccatgtatagacccagatttgctatgcaaatagtccagattcagttatggctggctacattattcagtaacttcccaacaggtagcacaaatattccttatggaaaaagcccaggactgttcagtagttcctcctgtacttttctgctggctacagtatggagtgccccatgggcacaggcccagccggagaacagaacggagggctctgggaagaggcagctcactggagagcctacattccttacacaagtgcctaaacagagtgatgccaacactccatctgccctgtccatcgccttcatagacagtctacttcgtgttccatcaccctttggggagggagctctttgcagacagtgtgttgtcaacttgggtacatttgggggcttggattaagggcactactccaggagggtccaatcattcaccagcatttgcagatgcccatagggaacaggtggctgtcacaactcccagcaacaagattttgttttctcctttttctttgcctcactctctccagttgggttttaagctagaatgaaaagcagtttcggtcctttggtatttatgtgccattcatgaaataaaagcaagagaatgctgggcacgatggcccatgtctgtaattctgttatctcagcactaaggctgaagcagaagatttgcaagttcagggtccacctgggctactcagtgaattccaggccagtgtgcactatgtagcaagaccatgtctccataaaaaagaccaagaaaaatgacttgggtgacagatcttgctgtgattttaaataattctttgagacttaactactgaccatgtgggttcttctcatttaaaggcagtatgcacacattacaaacagtgttgccaagcctcagcttgtttggatttggtttaagtggtgcattgtaccgagctctgggaggattccagcctcatcttagacagctctttctcctcccccaactccctcccatgcctccaccccacccccactgttcggctttccctttcctcttctggccttccctggcttccttttccttctccctcttccctcagcttgcttgctggctggcctgcctgcctgtctgcctgtgtgataatgaattctctgcatggctgcaatgatcccactgttagttggcaaggtcaggcttagctcattgactacagaagaccaaaatcctgtttctcatgcccagtggtgttagccctgggttgcactgtcctcaagcttacactaggtcagagcagcaggcctgtcaaactgacaaaactagtagggtttctggcaggttcaacacctctccattctgtggaggggcttggagaagaggcagtgaaggagaccgctgctttgaattcagtccagtgtgaccgattggttgaggtgctattggcagcctgttggggtcggcctggagctactgttactgggaacttaaacttggactttgactaaagttgaacagagtatgaaactgttctagaaatctagttctcaactgcgacatagctcctctgtgactgagcagcaaggctttccaacaggttccttttaaccagaattctatgaatgatgccggggacacagttttcttagctggcccatagaaggtctacaaggctgctaagtgttgtagacctggcatctggcatcacataggaggatggaatttcttccctttcaggatagaagagtcacctcttacctagccaaaaggcagttttgggaattcctgtcaggaggaaaggtttggttttgttttttaatttactgggctttagatggtagttcattatgccttccttgggcagggatcatggcagggatacgcaaggcactctaatactcggccttctaagcaggctgggaaagggggattctctggttttctctttctccccacttactaggacttgccttctccctgagccacgagagaggctgggttggtgctctccccttactctgctcctactgacttagaacctctggctgctgtatgatagcccaggaaagggaatggaaagaatgggctcaaaacaataatgtaaggaaggtggtttccttccttaaaaagggaaatcagaaactctccaagaattgtgtaagtaaagacaatgtgtctgaatgcactgagtcctctggtgtcatagcaataaggaaaaatgaattgactttctgtgcatacagtccagcctgactggtgtatgatgttgcacttagcagccatgtggtgggcatgtgtgactactctgggtttcactttattttctaaactttttattcctctcaagtccagcatggatggggaaatgtccctggagccccgcagctgtgtacttgtttgcatttgtttcccattgagacttgtgtttgtgtcctgctttgagctgtaccctgtcccgtccattgtgaaattatcccagcagctgtaatgtacagttcccttctcaagcaagcaacagcagcacaatcttgtgttttataaaaacaacagtggcttttatttctaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]