GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-26 23:54:10, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XM_010878662            4684 bp    mRNA    linear   VRT 11-MAY-2020
DEFINITION  PREDICTED: Esox lucius NRDE-2, necessary for RNA interference,
            domain containing (nrde2), mRNA.
ACCESSION   XM_010878662
VERSION     XM_010878662.4
DBLINK      BioProject: PRJNA629749
KEYWORDS    RefSeq.
SOURCE      Esox lucius (northern pike)
  ORGANISM  Esox lucius
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Protacanthopterygii;
            Esociformes; Esocidae; Esox.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_047583.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On May 11, 2020 this sequence version replaced XM_010878662.3.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Esox lucius Annotation Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4684
                     /organism="Esox lucius"
                     /mol_type="mRNA"
                     /isolate="fEsoLuc1"
                     /db_xref="taxon:8010"
                     /chromosome="15"
                     /tissue_type="liver, spleen"
                     /dev_stage="adult"
                     /country="Czech Republic: Jihlava River, Danube basin"
                     /lat_lon="49.218 N 16.717 E"
                     /collection_date="29-Nov-2018"
                     /collected_by="Martin Reichard"
     gene            1..4684
                     /gene="nrde2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 6 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 22 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:105015472"
     CDS             914..4438
                     /gene="nrde2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2"
                     /protein_id="XP_010876964.1"
                     /db_xref="GeneID:105015472"
                     /translation="
MALFPAFAALSNTKDENSPKDLEWLSNQSFRTDDALSIHQRATEKANEAEPAQTRLVTKEREDKNHISSKKKKKEKEKKKKKRKKHKKSGEPSPANSGSDSDTIYPSDLLKKAQSTSPSEEVKGQDEGSFVWLDDLQTPTDRPFCVDRRADRANWEYKSLYRGDIARYKRKGSSSLGLNPRSQAVSWAESGPEKKKSDRRNRPVRYFSPSVRQHLRSDGQPVLPSPPPEGGAITSPFIPVPPCLEVEVEGMAKGQSSWVNPLGVYDSATSLWLQGKGKAEHGRAEEPPPAPRDPSAALLAERVEDFNRRLRENPEDTHAWLRFVRFQDEVASGPGAFGDPPENETERRKSSVRATLEKKVAILDRAVDSNPGCVELKLERLRLCRELWEPAVLLKEWKKLVFVHPNSAPLWKKYLLFVQSHFSTFSVSKVNGVYGKCLSTLAAVQDGSMVSHDALPGTEEHMLGIFLQQCHFLRQAGHSEKAVCLFQGMLDFTFFKPDTVKDLPTRQQVEFFETFWDSGEPRVGERGARGWRAWMTQQERGGWLQPNEPDDEDDEDQEESEVKDMTWPKWKIWLDVETSREAVHWLPWRPDKTKGQSVEDCEDPDRQVLFDDIGPSMIRLVRPDLQLCLLLSFLHFLGLPADPSCYSAPSWSVLLDDLTLLEEVHDQDAPLTSYDLLVPGVSPVGHMTSLQGTRKGAGLCKQGEEFLDNMFQMILPLLPAQERAILSLHWIQYEKLKVLRCARGRNKKRLKAQGKRSKRLAKRLLKEPENRGRLSLWREYAHLEWLLGNLEEARKVFDTALGLGVSGGLADPALCDLCLLYAQLEVEEAWRVGSGGCGLGVNVATVTSSPAVYVLAKLAEGSSYAPFSGQLAPVAVLKARKTYEQAVESYLPGLVEGASGLGHAKKPRRVKGLVGCYALFQYLTVGIDATDAVYNLARERLEQQPNTAAQEQVVGELDWTRSTALECEALAVQRAALLRHHTDASVYPLGHLRLALTSALVRFPSSAPLWRLYVQVENRYHSAGRARRFFHSVTKVSASVVPRLFAISAEQRRKQLVDSVQRAGSYGDTLSTLPENGLSNRIRCLFENAIATEHGVHCPLLWRMYMNFLVSEGKVETGRGIFYKALQDIPWAKGLYMDAAQLFPDHVQEFLDLMTEKELRLRVPMEEVDILLED"
     misc_feature    1826..2827
                     /gene="nrde2"
                     /note="NRDE-2, necessary for RNA interference; Region:
                     NRDE-2; pfam08424"
                     /db_xref="CDD:285605"
ORIGIN      
tttgcggactgtaaaatactctccgcacctcgtgccaatgaactgacaggtttcaggcgcgctctactttatgcaacgcactgctttatatctgcggaagaatactttaaaatttactggccagtctctttgttgaagctggagaaattgcggttctttttgagacaccgctgctcattggttgcagtggacctgcaatattctgctcactgtacgagctcccaagattggctacgttggatctgcaatgcgtcaagcaatggcgattatgttacggattgtttcaggaaaacgatgtagcaggacagtctatatttgaccacaaagcattttgtcaatattgtattatttactttcgacaaaacgtgtttttagtctgtagtttctcaaaagtgtagactacctcttcatctgacagtggctcgatttgaggagtgggctgattcgcgattggtcactacaaatctacacggaactattttgtagtcgcgaaatttaaaatgacaggataagggatatgacatttccattgaataaattgtcttctattttcaacaaaatgttgtaaattcgagtactgaatttaaatcaatgtttactatatcgaaacaaaatgtttaataataaacgtcaatggtgatacctatttggcaataatctctaaccctgcagcattggatcgacaaaaacgtgttaacggtttgtccatgttcacgcagaggttatcgaattagttttgtatggtcatgcaataagaagcatatttaagtaatgaaaaaatcagtatggaagatgaccttagacagtagacaaacttccttaaaattcaagctgtctccagcaagtaactgacgcgttgaatgtgacgtcatattcacgcgactgtttacatccacacgaaaacattggcaacatggctctttttccagcttttgcagctttatcaaatactaaagatgagaattcacctaaagatttagaatggctgagcaatcaaagtttccgcaccgacgatgccctttctatccaccagcgagccactgagaaagccaacgaagcagaaccggcacaaacaagacttgttacaaaagagagggaggataagaatcacatctcatctaagaaaaagaaaaaggagaaggagaagaagaagaagaaaaggaagaagcacaagaagagtggagaaccctccccagcaaacagtggctcagattcagatactatctaccccagtgatctcctgaaaaaagcacagagcacttctcccagtgaggaggtaaagggtcaggacgaggggtcatttgtgtggttggatgacctccagacccccacagatcgacctttctgtgtggacaggagagcggaccgggccaattgggagtacaaatctctctacagaggagacatcgccaggtacaagaggaaaggcagttcctccctgggcttgaacccgcggtcccaggctgtgagctgggctgagtcgggcccagagaagaagaagtcggacaggcgaaacagacctgtccgctacttttctcccagcgtccgccagcacctgcggtcagacggccaacctgtgctccccagtccccctccggaaggcggcgccatcacctcgcccttcatcccggtgcccccctgcctggaagtcgaggtagagggcatggccaaggggcagtcctcctgggttaaccccctgggggtgtatgactcggccacctccctgtggcttcaggggaaggggaaggccgagcatggccgggcggaggaaccgcctcccgctcccagggacccctcggccgccctgctggctgaacgcgtggaggacttcaacaggaggctgagggaaaacccggaggacacgcatgcgtggctccgcttcgtccgcttccaggacgaggtggcgagtggccccggggcgttcggcgacccccccgagaatgagacggagcggcggaagagctcggtgcgggccacgctggagaagaaggtggccattttggatcgagcggtggacagtaaccccggctgcgtggagctgaagctggagcgactgcgactgtgcagagagctgtgggagcccgccgtcctgctgaaagagtggaagaagctggtgttcgtgcaccccaacagtgcccccctgtggaagaagtacctgctgttcgtgcagagccacttcagcaccttctcggtgtctaaggtcaacggcgtgtacggcaagtgtctgagcacgctggcggcggtgcaggacgggagcatggtgtctcacgatgcgttgccgggcactgaagaacacatgctaggcatcttcctgcagcagtgtcatttcctcaggcaggctggccactcggagaaagctgtgtgtctgttccagggcatgctggacttcacctttttcaagccagacactgtcaaggacctgcccacaagacaacaggtggagttctttgagacattctgggacagtggggagccccgggtcggggagagaggggccaggggatggagagcctggatgacccagcaggagagagggggttggctacaacccaatgaaccagatgacgaagatgacgaagatcaggaggaatctgaggtaaaggatatgacctggcccaagtggaagatctggttggatgtggagacttcacgtgaggctgtccattggttgccgtggaggccggacaagaccaagggccaatcagtggaggactgtgaggacccagatcgacaggtcctgtttgatgacattggtccgtctatgatccggctggtccgcccagacctccagctctgtcttcttctgtccttcctgcacttcctgggtcttcctgctgacccatcctgttacagcgccccctcctggagtgtgcttctggatgacctgactctgctggaagaagttcacgaccaagatgcccctttgacttcatacgaccttcttgtccctggggtcagccctgtaggtcacatgacctctcttcagggcaccaggaagggggcaggactgtgtaagcaaggggaggagtttctagacaacatgttccagatgattctgcctttgctgcctgctcaggagagagccatcctttcactgcattggatccagtatgagaagctcaaggtgctgaggtgtgcacgcggcaggaacaagaaacgcttaaaagcccaggggaagaggagcaaacgcctggctaaacgtctgcttaaagagccagagaaccgcggccgcctcagcctgtggagggagtacgcccacctggaatggctgctggggaatctggaggaggcccgcaaggtgtttgacacagccttgggcctgggtgtgtcaggggggctggcggacccagccctgtgtgacctctgcctgctctacgcccagctggaggtggaggaggcctggagggttgggtcgggcggatgtgggcttggggtgaacgtggcgacagtcacatcttcgcccgcggtctatgtcctcgccaagttagcggaggggagttcgtacgcccccttctctggacagttggctccagtggctgttctgaaggcccggaagacctatgagcaggctgtggagagctacctgcctgggctagtggagggggcctctgggttgggacacgccaagaaacccaggcgggtcaaaggtctggtaggttgttatgccctcttccagtacctgactgtggggatcgacgctaccgacgcggtctacaatctggcaagggagaggctggagcagcagcccaacacggcagcccaggagcaggttgtcggcgagctcgattggacccggagcaccgccttagagtgcgaggccctggctgtccagcgggcggctttgctgcgccaccacaccgacgctagcgtctacccgctcggccacctcaggctggcgctgacctcggcgctggtccgcttcccctctagcgcccctctgtggcggctgtacgtacaggtggagaaccgctaccacagtgctggaagggctcgccgcttcttccacagcgtgaccaaggttagcgccagtgtggtgccgcgcttgttcgccatcagcgcagagcagcggaggaaacagttggtggactctgttcagagggctggttcctatggcgacaccctgtcaaccctgccggagaatggcctgagcaaccgtatccgttgtctgtttgagaacgccatagcaacagagcacggggtccactgtcctttgctctggaggatgtacatgaacttcctggtgtcagaagggaaggtggagactggaagagggatcttctacaaggctctccaggacatcccgtgggcgaagggtttatacatggacgcggcgcagctcttccctgatcatgtgcaggagttcctggacctaatgacggagaaggagctccgactgagggttcccatggaggaggtggacattctgctggaggattgaggccatgaactacttccacagtttcctggaacctggcttttttagacagactgtggacacagaagccatgcacatgctaatagaaccaccaagtgtctgtgaacaaaataatgttgctcttcaaacagatgtgtttttctgggttaaataccttttccatattttgatggagtgaatatcgatttttatgtcaaggagatcaaaatgataaatagattactgtgaataaatgatttgtttccttac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]