2024-04-19 11:21:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_010616293 3983 bp mRNA linear ROD 23-APR-2020 DEFINITION PREDICTED: Fukomys damarensis NRDE-2, necessary for RNA interference, domain containing (Nrde2), transcript variant X1, mRNA. ACCESSION XM_010616293 VERSION XM_010616293.3 DBLINK BioProject: PRJNA625221 KEYWORDS RefSeq. SOURCE Fukomys damarensis (Damara mole-rat) ORGANISM Fukomys damarensis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Hystricomorpha; Bathyergidae; Fukomys. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_022900933.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Apr 23, 2020 this sequence version replaced XM_010616293.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Fukomys damarensis Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3983 /organism="Fukomys damarensis" /mol_type="mRNA" /isolate="Sample0158" /db_xref="taxon:885580" /chromosome="Unknown" /sex="female" /tissue_type="blood from cranial vena cava" /country="USA: Houston Zoo, Houston, TX" /collection_date="05-Sep-2016" /collected_by="Joseph P. Flanagan, Kelcie Pletch, Christine Molter, Maryanne Tocidlowski, Lauren Howard, Judilee Marrow, Andrea Lee, Jess Jimerson, Katie Plaeger, Erin Neer" gene 1..3983 /gene="Nrde2" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 20 samples with support for all annotated introns" /db_xref="GeneID:104856795" CDS 107..3679 /gene="Nrde2" /codon_start=1 /product="nuclear exosome regulator NRDE2 isoform X1" /protein_id="XP_010614595.1" /db_xref="GeneID:104856795" /translation="
MALFPAFAGVGEAPDSGVSRKELDWLSNPSFCVGTTASSLNQQTKEATALVSEGSTLTRSPLKSQPSDESDTNKKLTQISRKKKKEKKKKRKHQHYKKTKRKHGQSSSSESEPESDSGKDRLSRSIRSSQKESEKVSYGNNAAADVGHHSFWLEDIQTLTGEIFRTDRKPDPANWEYKSLYRGDIARYKRKGDSCLGINPKKQCVSWEGVSTVKKHSHKHVERYFTKKSVGLMNIDGVAITSKTEPPSSEPVLFIPVKDSDNVAAPVTTWLNPLGIYDQSTTQWLQGQGPSEQESKQPDSQPDGEDGILKAKVEEFNRKVRENPRDIQLWMSFVAFQDEVMRSPGLYAIEEGEQEKQKKSLKLILEKKLAILERAIDSNQSSVDLKLAKLKLCAEFWEPSTLVKEWQKLIFLHPNNSALWQKYLLFCQSQFSTFSISKIHNLYGKCLSTLSAVKDGSMLSHPALPGTEEAMFALFLQQCHFLRQAGHSEKAVSLFQAMIDFTFFKPDSVKDLPTKVQVEFFEPFWDSGEPRPGEKGARGWRAWMHQQERGGWVVISPDEDDDEPEEEEEEIRDKTLPRWQIWLGAERSRDERHWQPWRPDKTKKQTEEDCEDPERQVLFDDIGQSLIRLSSPDLQFQLIQAFLQFLGVPSGFTPPASCLYLAMDENSVFHNGLYEEKPLTFLNPSFSGVSCVGHMEQLGCPRWVRSHNREGEEFIRNTFHLVLPLFSGKQKSQLCFSWLRYEIAKVIWCVQTKNKKRLKSQGKNCKKLAKNLLKEPENRNNFCLWKQYAHLEWLLGNIEDARKVFDTAVSMAGSSELKDRELCELSLLYAELEVELLQDLRGAATGRAVHILTRLTESSLYGPYTGQVLATQVLKARKAYEHALQDCLGENCASGPAAANSLDCLSSLVKCFMLFQYLTVGIDAAARTYEQLFAKLKVSFVPGDPGLEHSASSQSLPSVLEAITLMHTSLLRFHMKVSVYPLTPLREALSEALKLYPGNQLLWWSYVQIQNKSHSASKTRRFFDAITRSAKPLEPWLFAIEAEKMRKRLVETVQRVDGREIHATIPETGLTHRIRALFENAMRSDNGSQCPLLWRMYLNFLVSLGNKERSKGVFYKALQNCPWAKVSFKDPDIFRFPRTFPPGLSSASITGDLSSGDAVPVPRHSQGLFLRSWNLWTLFCLRAGAHVSGW"
misc_feature 593..883 /gene="Nrde2" /note="MTR4-interacting domain (MID) found in nuclear exosome regulator NRDE2 and similar proteins; Region: NRDE2_MID; cd22200" /db_xref="CDD:412062" misc_feature order(593..619,626..631,641..646,650..652,656..700, 707..715,719..727,749..757,767..772,776..781,788..808, 833..844,854..883) /gene="Nrde2" /note="MTR4 binding site [polypeptide binding]; other site" /db_xref="CDD:412062" misc_feature 1049..2047 /gene="Nrde2" /note="necessary for RNA interference; Region: NRDE-2; pfam08424" /db_xref="CDD:429988" ORIGIN
atgaaaccacacttcccggcgtgcaccacgatagcgaaggccgccaacccgcggttgctagctggcgccatttccgtggaagagaacggcattgaggcctgtgatcatggcgctgttcccagcgtttgcgggcgttggtgaggccccagatagtggggtctctaggaaagaattagactggctgagtaacccaagcttttgtgttggaacaacagcatcatcgctgaaccaacaaaccaaggaggccacagcccttgtttctgaagggtccacactgacaaggagtcctttgaaatcacagccttcagatgagagtgacactaacaaaaagctcacacaaataagcagaaaaaagaagaaagaaaaaaagaaaaaaaggaagcatcagcactataagaagacgaagaggaaacatggacagtcgagtagcagtgagtctgagccggaaagtgactctggaaaggacagattgtcccgaagcatcaggagtagtcagaaggagtctgagaaagtcagttatggaaacaatgctgctgctgatgttgggcatcactctttctggcttgaggacatccagactctgacaggagaaatcttcagaacagataggaaaccggatcctgcaaactgggaatataagtctctttacagaggagatatagcaagatacaagaggaaaggagactcctgcctgggcattaaccctaagaagcagtgtgtatcttgggaaggagtttccacagtgaagaagcattcacacaagcatgttgagcgctattttaccaagaagagtgtgggactaatgaacatcgatggagttgctattaccagtaaaacagagcctccttcctctgagccagtcttgtttatcccagtgaaggactcagataatgtggctgctcctgttacgacctggttgaatcctctggggatttatgatcagtcaaccacacagtggctacaaggacaaggtccttcagagcaagaatcgaagcagccggactcccagccagatggagaggatggtattctcaaggccaaggtggaggagtttaacaggaaggttcgggagaatcctcgggatattcagctgtggatgtcgtttgtggcttttcaggatgaggtcatgaggagtcctggcctgtatgccattgaggagggagagcaggagaagcagaagaagtccctgaagctcatcctggaaaagaagctggccattctggagcgggccattgacagcaatcagagcagtgtggatctgaagctggccaagctgaagctgtgtgccgagttctgggagccttccacactggtcaaagagtggcagaaactgatcttcctccatcccaataatagtgctctttggcagaaataccttttattttgccagagccagtttagcaccttttcgatttcaaaaatccacaatctttatgggaagtgcttgagcactttgtctgcggttaaggacggcagcatgttatctcaccctgcattgcctggcacggaagaggccatgtttgcactctttcttcagcagtgccattttctgcggcaggctggccactcagagaaggctgtctctttgttccaggccatgatcgacttcaccttcttcaaacccgacagtgtgaaagatctgcctaccaaagtacaggtggaattctttgagcccttctgggatagtggagagccccggcctggggagaagggcgcccgaggctggcgggcctggatgcaccagcaggagcggggtggctgggtggtcatcagcccagatgaggatgatgatgaaccagaagaggaagaagaggagataagagacaagactctgcccaggtggcagatctggcttggtgctgagcgttcacgagacgaaagacactggcagccctggcgccctgataaaacaaagaaacaaactgaagaagactgtgaggatcctgagagacaggtgttgtttgatgacattggacaatcgctgatcagacttagcagcccagacctccagttccagctgatacaggcctttctgcagtttttgggtgtgccttctggcttcacccctccagcctcctgcctttacctggccatggatgagaacagcgtctttcacaacggactttatgaggagaagcccctgacttttttgaacccttcattttctggcgttagctgtgtcggccacatggagcagttgggctgtcctcgctgggtcaggagtcacaatcgagagggcgaggagttcatccgcaacaccttccaccttgtgttgcctttattttcaggcaagcaaaagtctcagctctgcttctcctggttacggtatgagattgcaaaggtaatttggtgtgtacaaactaaaaacaagaagagattaaagtcacaggggaagaactgcaaaaaactagccaagaatctccttaaggagccagaaaaccgcaacaatttttgcctctggaagcagtatgcacatctggagtggttgcttggcaacatagaggatgccagaaaagttttcgatacagcagtcagcatggcaggcagcagtgagctgaaggaccgtgagctctgtgagctcagcctgctctatgctgagctggaggtggagttgttgcaggacttgagaggggccgccacaggccgagctgttcacatactgaccaggctgacggagagcagtctctacgggccctacactgggcaggtcttggccactcaggttttgaaagctcgaaaggcttatgagcacgcactgcaggactgtctgggtgaaaactgtgcctctggtccagctgctgccaattccttggactgcctgagtagcttggttaagtgctttatgctcttccagtatttgacagtagggattgatgctgctgcacggacatatgagcagctttttgccaaactaaaggtctcctttgtcccaggggaccctggcttagagcacagtgccagctcccagagtttgcccagcgttcttgaagccatcaccctgatgcacacaagtctgctgagattccacatgaaagttagtgtttatcctctgactccactgcgggaagcactctcagaggctttaaaattgtatccaggcaaccagcttctttggtggtcatatgtacagattcaaaataagtcccacagtgctagcaagaccagaaggttcttcgatgcaatcactaggtctgccaaacccttggagccttggttgtttgcaattgaagctgagaaaatgaggaaaagactggtggaaactgttcagagggtagatggcagagagatccatgccaccatccccgagactggcttaacacatcggatcagagccctctttgaaaatgcgatgcggagtgacaatggcagccagtgccctttactgtggaggatgtatttgaattttctggtttccttaggaaacaaagaaagaagcaaaggtgtgttctacaaagcacttcagaattgtccttgggcaaaggtaagttttaaagacccagatatcttcagattcccaaggaccttcccaccaggcctcagctcagccagtatcactggggacctcagctctggggatgcagtacctgtcccaaggcacagccagggccttttcctaaggagttggaacctgtggacccttttctgtcttagagctggcgctcatgtgagtgggtggtgagtacctggtttcccaacatttgccaaagcaagctcattcactgaaagaattgggatccaggagacattcagaagtcaaactggtggtggctgcagtgtctgacaacacttttggctccctggaaagacaagggccacttggtgtttactggctttccctcttgttttgtgagtctggcttccttcctgaatacacctgagcaaggagagtctggaggaaaggggctgcgcgtagctatggagggcagcagagggcagcctcactggggacctgctcctttttctcagatttcctcatactcacc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]