GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-19 11:21:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_010616293            3983 bp    mRNA    linear   ROD 23-APR-2020
DEFINITION  PREDICTED: Fukomys damarensis NRDE-2, necessary for RNA
            interference, domain containing (Nrde2), transcript variant X1,
            mRNA.
ACCESSION   XM_010616293
VERSION     XM_010616293.3
DBLINK      BioProject: PRJNA625221
KEYWORDS    RefSeq.
SOURCE      Fukomys damarensis (Damara mole-rat)
  ORGANISM  Fukomys damarensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Hystricomorpha; Bathyergidae; Fukomys.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022900933.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Apr 23, 2020 this sequence version replaced XM_010616293.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Fukomys damarensis Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3983
                     /organism="Fukomys damarensis"
                     /mol_type="mRNA"
                     /isolate="Sample0158"
                     /db_xref="taxon:885580"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="blood from cranial vena cava"
                     /country="USA: Houston Zoo, Houston, TX"
                     /collection_date="05-Sep-2016"
                     /collected_by="Joseph P. Flanagan, Kelcie Pletch,
                     Christine Molter, Maryanne Tocidlowski, Lauren Howard,
                     Judilee Marrow, Andrea Lee, Jess Jimerson, Katie Plaeger,
                     Erin Neer"
     gene            1..3983
                     /gene="Nrde2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 20 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:104856795"
     CDS             107..3679
                     /gene="Nrde2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2 isoform X1"
                     /protein_id="XP_010614595.1"
                     /db_xref="GeneID:104856795"
                     /translation="
MALFPAFAGVGEAPDSGVSRKELDWLSNPSFCVGTTASSLNQQTKEATALVSEGSTLTRSPLKSQPSDESDTNKKLTQISRKKKKEKKKKRKHQHYKKTKRKHGQSSSSESEPESDSGKDRLSRSIRSSQKESEKVSYGNNAAADVGHHSFWLEDIQTLTGEIFRTDRKPDPANWEYKSLYRGDIARYKRKGDSCLGINPKKQCVSWEGVSTVKKHSHKHVERYFTKKSVGLMNIDGVAITSKTEPPSSEPVLFIPVKDSDNVAAPVTTWLNPLGIYDQSTTQWLQGQGPSEQESKQPDSQPDGEDGILKAKVEEFNRKVRENPRDIQLWMSFVAFQDEVMRSPGLYAIEEGEQEKQKKSLKLILEKKLAILERAIDSNQSSVDLKLAKLKLCAEFWEPSTLVKEWQKLIFLHPNNSALWQKYLLFCQSQFSTFSISKIHNLYGKCLSTLSAVKDGSMLSHPALPGTEEAMFALFLQQCHFLRQAGHSEKAVSLFQAMIDFTFFKPDSVKDLPTKVQVEFFEPFWDSGEPRPGEKGARGWRAWMHQQERGGWVVISPDEDDDEPEEEEEEIRDKTLPRWQIWLGAERSRDERHWQPWRPDKTKKQTEEDCEDPERQVLFDDIGQSLIRLSSPDLQFQLIQAFLQFLGVPSGFTPPASCLYLAMDENSVFHNGLYEEKPLTFLNPSFSGVSCVGHMEQLGCPRWVRSHNREGEEFIRNTFHLVLPLFSGKQKSQLCFSWLRYEIAKVIWCVQTKNKKRLKSQGKNCKKLAKNLLKEPENRNNFCLWKQYAHLEWLLGNIEDARKVFDTAVSMAGSSELKDRELCELSLLYAELEVELLQDLRGAATGRAVHILTRLTESSLYGPYTGQVLATQVLKARKAYEHALQDCLGENCASGPAAANSLDCLSSLVKCFMLFQYLTVGIDAAARTYEQLFAKLKVSFVPGDPGLEHSASSQSLPSVLEAITLMHTSLLRFHMKVSVYPLTPLREALSEALKLYPGNQLLWWSYVQIQNKSHSASKTRRFFDAITRSAKPLEPWLFAIEAEKMRKRLVETVQRVDGREIHATIPETGLTHRIRALFENAMRSDNGSQCPLLWRMYLNFLVSLGNKERSKGVFYKALQNCPWAKVSFKDPDIFRFPRTFPPGLSSASITGDLSSGDAVPVPRHSQGLFLRSWNLWTLFCLRAGAHVSGW"
     misc_feature    593..883
                     /gene="Nrde2"
                     /note="MTR4-interacting domain (MID) found in nuclear
                     exosome regulator NRDE2 and similar proteins; Region:
                     NRDE2_MID; cd22200"
                     /db_xref="CDD:412062"
     misc_feature    order(593..619,626..631,641..646,650..652,656..700,
                     707..715,719..727,749..757,767..772,776..781,788..808,
                     833..844,854..883)
                     /gene="Nrde2"
                     /note="MTR4 binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:412062"
     misc_feature    1049..2047
                     /gene="Nrde2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:429988"
ORIGIN      
atgaaaccacacttcccggcgtgcaccacgatagcgaaggccgccaacccgcggttgctagctggcgccatttccgtggaagagaacggcattgaggcctgtgatcatggcgctgttcccagcgtttgcgggcgttggtgaggccccagatagtggggtctctaggaaagaattagactggctgagtaacccaagcttttgtgttggaacaacagcatcatcgctgaaccaacaaaccaaggaggccacagcccttgtttctgaagggtccacactgacaaggagtcctttgaaatcacagccttcagatgagagtgacactaacaaaaagctcacacaaataagcagaaaaaagaagaaagaaaaaaagaaaaaaaggaagcatcagcactataagaagacgaagaggaaacatggacagtcgagtagcagtgagtctgagccggaaagtgactctggaaaggacagattgtcccgaagcatcaggagtagtcagaaggagtctgagaaagtcagttatggaaacaatgctgctgctgatgttgggcatcactctttctggcttgaggacatccagactctgacaggagaaatcttcagaacagataggaaaccggatcctgcaaactgggaatataagtctctttacagaggagatatagcaagatacaagaggaaaggagactcctgcctgggcattaaccctaagaagcagtgtgtatcttgggaaggagtttccacagtgaagaagcattcacacaagcatgttgagcgctattttaccaagaagagtgtgggactaatgaacatcgatggagttgctattaccagtaaaacagagcctccttcctctgagccagtcttgtttatcccagtgaaggactcagataatgtggctgctcctgttacgacctggttgaatcctctggggatttatgatcagtcaaccacacagtggctacaaggacaaggtccttcagagcaagaatcgaagcagccggactcccagccagatggagaggatggtattctcaaggccaaggtggaggagtttaacaggaaggttcgggagaatcctcgggatattcagctgtggatgtcgtttgtggcttttcaggatgaggtcatgaggagtcctggcctgtatgccattgaggagggagagcaggagaagcagaagaagtccctgaagctcatcctggaaaagaagctggccattctggagcgggccattgacagcaatcagagcagtgtggatctgaagctggccaagctgaagctgtgtgccgagttctgggagccttccacactggtcaaagagtggcagaaactgatcttcctccatcccaataatagtgctctttggcagaaataccttttattttgccagagccagtttagcaccttttcgatttcaaaaatccacaatctttatgggaagtgcttgagcactttgtctgcggttaaggacggcagcatgttatctcaccctgcattgcctggcacggaagaggccatgtttgcactctttcttcagcagtgccattttctgcggcaggctggccactcagagaaggctgtctctttgttccaggccatgatcgacttcaccttcttcaaacccgacagtgtgaaagatctgcctaccaaagtacaggtggaattctttgagcccttctgggatagtggagagccccggcctggggagaagggcgcccgaggctggcgggcctggatgcaccagcaggagcggggtggctgggtggtcatcagcccagatgaggatgatgatgaaccagaagaggaagaagaggagataagagacaagactctgcccaggtggcagatctggcttggtgctgagcgttcacgagacgaaagacactggcagccctggcgccctgataaaacaaagaaacaaactgaagaagactgtgaggatcctgagagacaggtgttgtttgatgacattggacaatcgctgatcagacttagcagcccagacctccagttccagctgatacaggcctttctgcagtttttgggtgtgccttctggcttcacccctccagcctcctgcctttacctggccatggatgagaacagcgtctttcacaacggactttatgaggagaagcccctgacttttttgaacccttcattttctggcgttagctgtgtcggccacatggagcagttgggctgtcctcgctgggtcaggagtcacaatcgagagggcgaggagttcatccgcaacaccttccaccttgtgttgcctttattttcaggcaagcaaaagtctcagctctgcttctcctggttacggtatgagattgcaaaggtaatttggtgtgtacaaactaaaaacaagaagagattaaagtcacaggggaagaactgcaaaaaactagccaagaatctccttaaggagccagaaaaccgcaacaatttttgcctctggaagcagtatgcacatctggagtggttgcttggcaacatagaggatgccagaaaagttttcgatacagcagtcagcatggcaggcagcagtgagctgaaggaccgtgagctctgtgagctcagcctgctctatgctgagctggaggtggagttgttgcaggacttgagaggggccgccacaggccgagctgttcacatactgaccaggctgacggagagcagtctctacgggccctacactgggcaggtcttggccactcaggttttgaaagctcgaaaggcttatgagcacgcactgcaggactgtctgggtgaaaactgtgcctctggtccagctgctgccaattccttggactgcctgagtagcttggttaagtgctttatgctcttccagtatttgacagtagggattgatgctgctgcacggacatatgagcagctttttgccaaactaaaggtctcctttgtcccaggggaccctggcttagagcacagtgccagctcccagagtttgcccagcgttcttgaagccatcaccctgatgcacacaagtctgctgagattccacatgaaagttagtgtttatcctctgactccactgcgggaagcactctcagaggctttaaaattgtatccaggcaaccagcttctttggtggtcatatgtacagattcaaaataagtcccacagtgctagcaagaccagaaggttcttcgatgcaatcactaggtctgccaaacccttggagccttggttgtttgcaattgaagctgagaaaatgaggaaaagactggtggaaactgttcagagggtagatggcagagagatccatgccaccatccccgagactggcttaacacatcggatcagagccctctttgaaaatgcgatgcggagtgacaatggcagccagtgccctttactgtggaggatgtatttgaattttctggtttccttaggaaacaaagaaagaagcaaaggtgtgttctacaaagcacttcagaattgtccttgggcaaaggtaagttttaaagacccagatatcttcagattcccaaggaccttcccaccaggcctcagctcagccagtatcactggggacctcagctctggggatgcagtacctgtcccaaggcacagccagggccttttcctaaggagttggaacctgtggacccttttctgtcttagagctggcgctcatgtgagtgggtggtgagtacctggtttcccaacatttgccaaagcaagctcattcactgaaagaattgggatccaggagacattcagaagtcaaactggtggtggctgcagtgtctgacaacacttttggctccctggaaagacaagggccacttggtgtttactggctttccctcttgttttgtgagtctggcttccttcctgaatacacctgagcaaggagagtctggaggaaaggggctgcgcgtagctatggagggcagcagagggcagcctcactggggacctgctcctttttctcagatttcctcatactcacc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]