GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2022-01-22 12:29:00, GGRNA.v2 : RefSeq release 209 (Nov, 2021)

LOCUS       XM_009900537             774 bp    mRNA    linear   VRT 24-OCT-2014
DEFINITION  PREDICTED: Picoides pubescens aquaporin 8 (AQP8), mRNA.
ACCESSION   XM_009900537
VERSION     XM_009900537.1
DBLINK      BioProject: PRJNA263502
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Dryobates pubescens (Downy woodpecker)
  ORGANISM  Dryobates pubescens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Piciformes; Picidae; Dryobates.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_009663629.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Picoides pubescens Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 10% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..774
                     /organism="Dryobates pubescens"
                     /mol_type="mRNA"
                     /isolate="BGI_N307"
                     /db_xref="taxon:118200"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="USA"
     gene            1..774
                     /gene="AQP8"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 13 Proteins"
                     /db_xref="GeneID:104300282"
     CDS             1..774
                     /gene="AQP8"
                     /codon_start=1
                     /product="aquaporin-8"
                     /protein_id="XP_009898839.1"
                     /db_xref="GeneID:104300282"
                     /translation="
MATGERGHPVVKEMMVLDVQTKPPRPHWYELYLQPCVAELLGTALFVFTGCLSVLKDSRDTGLLQPALAHGLALGPIISILGGISGGHLNPAASLAVWLAGGLNITMLIPYWLSQLCGGVIGAGLAKAVVEQESYRNSTGGAFSIITSDEQVPSALVNEVIMTSFLFLVVCMGAVNGKTKSPLAPVCIGFTVTATVLAGGSVSGACMNPARAFGPALLAGCWDYHWVYWVGPTLAALLVSGTVRLLLGDQSTRLILK"
     misc_feature    106..714
                     /gene="AQP8"
                     /note="Major intrinsic protein (MIP) superfamily. Members
                     of the MIP superfamily function as membrane channels that
                     selectively transport water, small neutral molecules, and
                     ions out of and between cells. The channel proteins share
                     a common fold: the N-terminal...; Region: MIP; cl00200"
                     /db_xref="CDD:294134"
     misc_feature    order(208..210,262..270,610..615,622..624,631..633)
                     /gene="AQP8"
                     /note="amphipathic channel; other site"
                     /db_xref="CDD:238204"
     misc_feature    order(268..276,622..630)
                     /gene="AQP8"
                     /note="Asn-Pro-Ala signature motifs; other site"
                     /db_xref="CDD:238204"
ORIGIN      
atggccactggcgagcgtggtcaccccgtggtgaaggagatgatggtgctggacgtgcagaccaagcccccacggcctcactggtacgagctctacctgcagccctgcgtggccgagctgctgggcactgcgctcttcgtcttcaccggctgcctctccgtgctcaaggactccagggacacggggctgctgcagcctgccctcgcccacgggctggcattgggccccatcatctccatcctgggaggcatcagtggaggccacctcaaccctgcagcatccctggcagtgtggctggctggagggctgaacatcaccatgcttattccttactggctctcccagctctgtggaggggtgataggagctggcctggcaaaggctgtggtggagcaggagtcctacaggaattccacaggaggagccttcagcatcatcacaagtgatgagcaggtcccctctgccctggtgaacgaggtcatcatgacctccttcctgttcttggtggtctgcatgggagccgtcaatgggaagaccaagtccccgctggctccggtctgcatcggcttcaccgtcacagccaccgtgctggcaggaggcagcgtgtctggagcctgcatgaaccctgccagagcctttgggcccgcgctgctggccggctgctgggactaccactgggtgtactgggtgggacccactctggctgccctcctggtcagtgggacagtgaggctgctgctgggtgaccagagcacccgcctgatcctgaagtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]