2025-09-18 11:31:54, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_009204731 2998 bp mRNA linear PRI 20-NOV-2019 DEFINITION PREDICTED: Papio anubis argonaute RISC catalytic component 3 (LOC101005189), transcript variant X12, mRNA. ACCESSION XM_009204731 VERSION XM_009204731.3 DBLINK BioProject: PRJNA576697 KEYWORDS RefSeq. SOURCE Papio anubis (olive baboon) ORGANISM Papio anubis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Cercopithecidae; Cercopithecinae; Papio. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_044976.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Jul 26, 2017 this sequence version replaced XM_009204731.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Papio anubis Annotation Release 104 Annotation Version :: 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2998 /organism="Papio anubis" /mol_type="mRNA" /isolate="15944" /db_xref="taxon:9555" /chromosome="1" /sex="male" /tissue_type="whole blood" gene 1..2998 /gene="LOC101005189" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 37 ESTs, 10 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 23 samples with support for all annotated introns" /db_xref="GeneID:101005189" CDS 402..2282 /gene="LOC101005189" /codon_start=1 /product="protein argonaute-3 isoform X5" /protein_id="XP_009202995.1" /db_xref="GeneID:101005189" /translation="
MCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYTLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYETDPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
misc_feature 402..743 /gene="LOC101005189" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(537..539,582..584,624..626,636..638,690..692, 711..713,717..719) /gene="LOC101005189" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 876..2153 /gene="LOC101005189" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1287..1289,1299..1301,1335..1346,1353..1355, 1377..1379,1386..1388,1398..1400,1410..1412) /gene="LOC101005189" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1491..1493,1497..1499,1707..1709,2121..2123) /gene="LOC101005189" /note="active site" /db_xref="CDD:240015" ORIGIN
tttatttactttgcatgtagtccctgaagtgggattgctagatcatatagtagttctatttttaatgttttgaggaacctccatactgttttctgtaaaggctgcaacaagggtttattaattgccaataaaatgctgctgtgaaaaataatgagaaatattgcactgacgatgttacttggttacatttccttttttgcttttgcgtgattttgattttggaagccttgtacgtggtatactgcactgaactaaacagcctttattgaacttgaaatcagctggagaagactggtattgagcactatattagaaacgggaaatgtttctaaagtttatttggatggaagtttagcatttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttcttgatattcataatattgatgagcaaccaagacctctgactgattctcatcgggtaaaattcaccaaagagataaaaggtttgaaggttgaagtgactcattgtggaacaatgagacggaaataccgtgtttgtaatgtaacaaggaggcctgccagtcatcaaacctttcctttacagttagaaaatggccaaactgtggagagaacagtagcgcagtatttcagagaaaagtatactcttcagctgaagtacccgcaccttccctgcctgcaagtcgggcaggagcagaaacacacctacctgccgctagaagtctgtaatattgtggcagggcaacgatgtatcaagaagctaacagacaatcagacttccactatgatcaaggcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgaaacggatccatttgttcaggagtttcaatttaaagttcgggatgaaatggctcatgtaactggacgcgtacttccagcacctatgctccagtatggaggacggaatcggacagtagcaacaccaagccacggagtatgggatatgcgagggaagcaattccacacaggagttgaaatcaaaatgtgggctatcgcttgttttgccacacagaggcagtgcagagaagaaatattgaagggtttcacagaccagctgcgtaagatttctaaggatgcagggatgcccatccagggccagccatgcttctgcaaatatgcacagggggcagacagcgtagagcccatgttccggcatctcaagaacacatattctggcctacagcttattatcgtcatcctgccagggaagacaccagtgtatgcggaagtgaaacgtgtaggagacacacttttgggtatggccacacaatgtgttcaagtcaagaatgtaataaaaacatctcctcaaactctctcaaacttgtgcctaaagataaatgttaaactcggaggaatcaataatattcttgtacctcatcaaagaccttctgtgttccagcaaccagtgatctttttgggagccgatgtcactcatccacctgctggtgatggaaagaagccttctattgctgctgttgtaggtagtatggatgcccacccaagcagatactgtgccacagtaagagttcagagaccccgacaggagatcatccaggacttggcctccatggtccgggaacttcttattcaattttataagtcaactcggttcaagcctactcgtatcatcttttatcgggatggtgtttcagaagggcagtttaggcaggtattatattatgaactactagcaattcgagaagcctgcatcagtttggagaaagactatcaacctggaataacctacattgtagttcagaagagacaccacactcgattattttgtgctgataggacagaaagggttggaagaagtggcaatatcccagctggaacaacagttgatacagacattacacacccatatgagtttgatttttacctctgtagccatgctggaatacagggtaccagtcgtccttcacactatcatgttttatgggatgataactgcttcactgcagatgaacttcagctgctaacttaccagctctgccatacttatgtacgctgtacacgatctgtttctatacctgcaccagcgtattacgctcacctggtagcatttagagccagatatcatcttgtggacaaagaacatgacagtgctgaaggaagtcacgtttcaggacagagcaatgggcgagatccacaagctcttgccaaggctgtacagattcaccaagataccttacgcacaatgtactttgcttaaatagtccaagtatattctctgagaggaagcactgaaagatgaactgacatacaacgtatgtttccagtggagtcaattgagtaaggacacctccagccatacagaaaccaacactgtgtgggggccaaggtctgatccttatgttaatacaaggaagattgtttacttcatcaaggaacacagcatcattatgcaatatgaaaccagccaactgctttttgtgcggtctcctgtaggaagtatcgcaattgttttgttttcatttcttgtagtctaacccttttaatgcctttacctcaagttgcttggcagcacaactatctttgcaaaaaaagtatcgaaaaagtaaatgatggtttaaaaaatatacaccttcatgaataatcaaagtgatttttcaaaattatgtgcaaaaaattaatgtgcattcatatattcttgtaaaaggtgtctgtgtgtttttaaaatatatacatccatacttcatatgcatatatatctggatctggattgataatagatatatatgtgtctgtgtatatattttagaattcattccatttggggaacttcctttcccttttattctactagcactaccgcttttatttctctttttcccttgccttcatcacctacattttttccctaatcctaccagtgacattcaaatattcacctacctggttcgtttgaatgtaaaatatggcaaacta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]