GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-02-27 21:13:45, GGRNA.v2 : RefSeq release 98 (Jan, 2020)

LOCUS       XM_009101819            4232 bp    mRNA    linear   VRT 08-AUG-2019
DEFINITION  PREDICTED: Serinus canaria NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), mRNA.
ACCESSION   XM_009101819
VERSION     XM_009101819.3
DBLINK      BioProject: PRJNA558035
KEYWORDS    RefSeq.
SOURCE      Serinus canaria (Common canary)
  ORGANISM  Serinus canaria
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Passeroidea;
            Fringillidae; Carduelinae; Serinus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022044854.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Aug 8, 2019 this sequence version replaced XM_009101819.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Serinus canaria Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4232
                     /organism="Serinus canaria"
                     /mol_type="mRNA"
                     /isolate="sc_yellow_7_cibi"
                     /db_xref="taxon:9135"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="heart"
                     /dev_stage="adult"
                     /ecotype="domestic yellow"
     gene            1..4232
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 10 ESTs, 3 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 5 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:103826482"
     CDS             47..3553
                     /gene="NRDE2"
                     /codon_start=1
                     /product="protein NRDE2 homolog"
                     /protein_id="XP_009100067.1"
                     /db_xref="GeneID:103826482"
                     /translation="
MALFPAFAGAAQPGEPPAGSSEGSTRELDWLSNPSFSAEDALLLHQRTTEATNLIPEKSPLIRTSSRSELSEESDTDESLKQTSKKRKKKKKKHHHNKKTKKKTKGDSSSSESEVDTKHIKDKGSGKSSEKEAAANVGKKASGVTSSHSIWLDDIQAPRADTFRIDKKPDPANWAYKSLYRGDIARYKRKGESCLGIDAKKQCISWDSSASKRKQAQSRPERYFTKNNVKMLNTDGILVCNKNSPSDPPAFIPVSQVETDDSSDTIEVNPLGIYDPSTTVWLQGKGCKSADSESVNTQQTVQEPGINMNSILMTKVEEYNKRVRENPRDINAWMEFISFQDELMRGPSPYASKGEQELRRKSLKLILEKKLAILERAIESNPSNVDLKLARLKLCTEFWEPPAVIKEWQKLIFLHPNNPEMWKKYLLFCQSQFTTFSVSKINSLYGKCLTTLAAVQDGSMVSHPLLPGTEEAMLAIFIQQCHFLRQAGHSEKAVSLFQALIDFTFFKPDSVKDLPTRGQVEFFEPFWDSGEPRIGEKGARGWKAWMHQQEKGGWVVLKPDDEDEEDLDEDQEIKDKTLPKWHIWLDIEYSREARHWLPWRPDKTKKETEEDCEDPERQVLFDDLGPSLIRLSNPKLQHQLLYSFLQFLGVPCASKLFPSSLYIAMDENNIFDSVLYDDKPLTSVDFPLSGFNSIGHMDTMSRGRHQIGHYKEGEEFIQNVFHVLSQIFTGKEKSNLAICWLQYEISKVIQCLQAKKKKKLKAQGRKSKKLAKNFLKAPDNRNNLSLWKLYAYLEWLLGNTDDSRKVFDTALCTAGTGGLKSVQLCSLSLLYAQLEVELLESMEGAVTSPAVHILTKLTESGPYVPYSGQVSPVNVLKARKTYEHALQDYLSKTAVSDQDQVCGTDQLVNLVGCYALFQYLTVGIDAAVLIYTQASEKLEVSSSQKCENTGENFGILNFPTALEAVTLLHTNLLRFHMKISVYPLNPLREALTEALKRYPSNQSLWRSYIHIQRKSHSASKARRFFDSVTRSTNSLEPWLFAIQAEQMRKKLTEKVQRADVGEIHCTIPETGLTNRIVALFEHAVQSENGTHCPLLWRMYLNFMASLGKKEKSKGLFYKALQNCPWAKVLYMDAVEYFPEDLQETFDLMTEKELRVRVPMEELDLLLEI"
     misc_feature    998..1993
                     /gene="NRDE2"
                     /note="NRDE-2, necessary for RNA interference; Region:
                     NRDE-2; pfam08424"
                     /db_xref="CDD:285605"
ORIGIN      
catcttgccgccggcagctcgggtggggggcggcggcggtcgagacatggcgctgttcccggccttcgccggggccgcccagccaggggagccccccgccggcagctccgagggctccacgagagagttagactggcttagtaacccaagcttctctgcagaagatgcactactactgcaccagcgcactacagaagctaccaatctcattcctgaaaaatcgccattaataaggacttcttcaagatctgagttgtcagaggagagtgatacggatgagagtctgaaacagacaagtaagaaaaggaaaaagaaaaagaaaaagcatcaccacaataagaagacaaaaaagaaaaccaaaggggattccagtagcagcgaatcggaggtggacactaagcacatcaaggacaaaggaagtggcaaaagtagtgaaaaggaagctgcagcaaatgtaggtaagaaagcatcaggtgttaccagcagtcactctatttggcttgatgacatccaggcccccagagcagacaccttccggatagacaagaaaccagaccctgcaaactgggcctacaaatccttgtatcgtggggacatagcaaggtataaaaggaaaggagagtcctgtcttggcatagatgcaaagaaacagtgcataagttgggacagttctgcatcaaaaaggaagcaagcacagagtcgacctgagcgctactttacaaagaacaatgtgaagatgctgaacacagatgggattcttgtatgtaataaaaattctccatctgatccacctgcttttataccagtttcccaagtggaaactgatgattcttctgacacaatagaagtaaatcctcttgggatttatgatccatcaaccacagtgtggctgcaaggaaaagggtgcaagagtgcagatagtgagtctgtaaatacacagcaaacagttcaagagcctgggataaacatgaactccattctaatgacaaaagtggaagaatataacaagagagttagagaaaacccaagagatattaatgcttggatggaatttatttcctttcaggatgaattaatgagaggacctagcccttatgccagcaagggagagcaagaattaaggagaaaatcactcaagttaatcttggaaaagaaactggccattttggagagggcaattgaaagcaatccaagtaatgttgatctgaaacttgccaggctgaagctttgcacagaattctgggaaccaccagctgtgatcaaagaatggcagaagctaatttttttgcatcccaataatccagagatgtggaagaaataccttctgttctgtcaaagtcagttcactaccttttctgtttcaaagatcaacagtctctatggaaaatgtttgacaacactggcagctgtacaggatggcagcatggtgtcccatcctctgctgcctggcactgaggaagctatgctggctatatttattcagcagtgccactttctgagacaggctggccattctgagaaagcagtgtctttgtttcaggctctgattgacttcaccttctttaaacctgacagtgtaaaagatctgccaacaaggggacaggtggaattctttgaacccttttgggatagtggagaaccacgaattggagaaaaaggagcaagaggctggaaagcatggatgcaccaacaagaaaagggtggctgggttgttctcaagcctgatgatgaggatgaggaagacttagatgaagatcaagaaataaaagataaaactcttcccaagtggcatatttggttggatattgaatattcccgggaggcaaggcactggttaccttggaggccagacaaaaccaaaaaggaaactgaagaagattgtgaagatccagaaagacaggtgttatttgatgatcttggaccgtctttaatccgtctttcgaatccaaagcttcaacatcaactcttgtactcttttttgcaattcctgggagttccatgtgcaagtaaactctttccttccagtctctatattgccatggatgaaaataacatctttgacagtgtgctctatgatgataaaccactgacttctgttgattttccactctctggattcaacagtattggtcatatggatacaatgtcacgaggcagacatcagataggccactataaagaaggagaggagttcatacagaatgtcttccatgttctgtcccagatatttacaggaaaggaaaaatctaacctggccatttgttggctacagtatgaaatatctaaggtaattcagtgtctccaagcaaaaaagaaaaagaagctaaaagcacaagggaggaagagtaaaaagttggccaagaattttcttaaagcacctgacaatcgaaacaacctttctctctggaaactctatgcctacctagagtggctgcttggtaacacagatgattccaggaaggtgtttgacacagctctttgcacagcagggacaggaggattgaagagtgttcagctctgcagcctcagcctgctgtacgctcagctggaagtggaactgctggaaagtatggaaggagctgtcacgtctcctgctgttcatatattgaccaaattgactgaaagtggaccatatgtgccctatagtggacaagtgtcacctgtgaatgtcttgaaagctcgtaaaacatatgagcatgcactgcaagattatttaagtaaaacagcagtttctgatcaggatcaggtctgtggtactgatcagctggttaacctggttggttgttatgcactgtttcagtatttgactgttgggatcgatgctgcagtattaatatatacgcaggcttcagaaaaacttgaagtttctagttcacagaaatgtgaaaatactggagagaattttggcattctaaattttcccactgctcttgaagctgtcacactgctgcatacaaatttactgagattccacatgaaaatcagtgtttatcctttgaatcccctgcgagaggcactaacagaggctctgaaacggtatcctagcaaccagtctctttggaggtcatacatccacatccaaaggaagtctcacagtgcaagcaaagcacgaagattttttgatagtgtcacaaggtctactaactctttagagccatggctgtttgcaatccaagcagagcagatgagaaaaaagctcacagagaaagtccagagggcagatgttggtgaaatacattgtactattcctgaaactggattaacaaatcggattgtagctctgtttgaacatgcagttcagagtgaaaatggtacccattgtccactgctatggagaatgtatttgaactttatggcttcactaggaaaaaaagaaaaaagtaaaggattgttttataaagctcttcaaaactgtccttgggcaaaggtgctctatatggatgcagtggagtatttccctgaggatctgcaggagacattcgatctaatgactgaaaaagagttgagagtgcgggtgcctatggaagagctggatctactactagagatttaaaagctagtagaagtacagaagctgcttccaaagctaacaattagattcattttcatccagaaactctgttgggacttgggtactatgtacttggcatttttttgttaaatattttatataaattcctatgaaaatggagttctactacctgcaagtgttctggaatcaaggactgcattttgcccacaataatggatccatttctctgcaatattgctgctcccacagaaggatagcctccttaaatagcctcctgttggaaattgcctgcattcttactctattgtttgaaattacattccctagggttcagtagaggtttggtacatgctagctatggcttgatgagcagcacaggaaataaacatctgccaaatggatgttccattgtccaccagttggcagacttcagtaatttccttcagcgtggtctggctgtgcatatgcaactgccaagtcaaacagccattacgtctgtacaaatactgtaaaagataaatttttgtttgagcaggcacctattttggtatgttttgacagatgatcatttaaatgtaaatctttctgaaaaatattcgtgcatatttgaaaattcaaaagtaacttgttttttatgtattaatttaatagaactgagtgtattaaaaattaaaatgtgtccataatgcatctctaagca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]