GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-02-27 21:10:52, GGRNA.v2 : RefSeq release 98 (Jan, 2020)

LOCUS       XM_008821748            3796 bp    mRNA    linear   ROD 24-JUN-2019
DEFINITION  PREDICTED: Nannospalax galili NRDE-2, necessary for RNA
            interference, domain containing (Nrde2), transcript variant X1,
            mRNA.
ACCESSION   XM_008821748
VERSION     XM_008821748.3
DBLINK      BioProject: PRJNA254049
KEYWORDS    RefSeq.
SOURCE      Nannospalax galili (Upper Galilee mountains blind mole rat)
  ORGANISM  Nannospalax galili
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Sciurognathi; Muroidea; Spalacidae; Spalacinae; Nannospalax.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_008358490.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 24, 2019 this sequence version replaced XM_008821748.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Nannospalax galili Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3796
                     /organism="Nannospalax galili"
                     /mol_type="mRNA"
                     /isolate="Female #2095"
                     /db_xref="taxon:1026970"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="brain"
                     /country="Israel: Animal Facility of the Institute of
                     Evolution, University of Haifa"
     gene            1..3796
                     /gene="Nrde2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 mRNAs, 1 EST, 2 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 12 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:103724617"
     CDS             70..3585
                     /gene="Nrde2"
                     /codon_start=1
                     /product="protein NRDE2 homolog isoform X1"
                     /protein_id="XP_008819970.1"
                     /db_xref="GeneID:103724617"
                     /translation="
MEGAEVRPVSMALFPAFAGVSEAAGSGDSRRELDWLSNPSFCVGNLTSLSQQTEEAPALASGGSPLKRSPLQSELSDDSDSSKKLTQISRKKKKERKKKRKHQHRKKTKKKHEQSSTTGSESDSDLGKDRSSRTLGSQKESEKPNSQGHNAAADTGHCSIWLEDIQSLTGEVFRTDKKPDPANWEYKSLYRGDIARYKRKGDSCLGINPKKQCISWEGASAAKRRSHKQLERYFTKKNVGLMSIDGMAVSSNAEPLSSEPATFIPVRDSADVAVPGTTWLNPLGIYDQSTTQWLQGQGPTEQESKQPDSQEDRERAVLKARVEEFNRKVRENPRDTQLWMAFVAFQDEVMRSPGLYALEEGEQEWRKKSLKLLLEKKLAVLERAIESNPSSMDLKLAKLKLCAEFWEPSMLVKEWQKLIFLHPNNTALWQKYLLFCQSQFSTFSISKIHSLYGKCLSTLSAVRDGSILSHPAEPGTEDAMFVLFLQQCHFLRQAGHSEKVISLFQAMVDFTFFKPDSVKELPTKVQVEFFEPFWDSGEPRAGEKGARGWRAWMHQQERGGWVVVNQDEDDDEPEEEEQEIKDKTLPRWQIWLAAERSRDQRHWQPWCPDKTKKQTEDDCEDPERQVLFDDIGQSLIRLCSPDLQFQLIEAFLQFLGVPSGFLPPASCLYLAMDESSVFDSGLYDEKPLTFFDPSFSGISCVGHMNQLGCPRWTRGHNREGEEFVRNIFHLVLPLFSGRRKSQLCFSWLRYEIAKVIWCLHTKKKKLKSQGKNCKKLAKNLLKEPENRNNFCLWKQYAYLEWLLGNIEDARKVFDTALSMAGSSELKDRELCELGLLYAELEVEVSPDLRGAATGRAVHILTRLTENSPYGSYTGQVLATHVLKARKAYDHALQDCLGASGASGPAPAESLDCLSSLVKCFMLFQYLTVGIDAAVQIYEQVFANLKGSVLPEGPGEENSQSLTSVLEAVTLMHTSLLRFHMKVSPYPLTPLRETLSEALKLYPGNQVLWRAYVQIQSKSHSANKTRRFFDAVTRSAKPLEPWLFAIEAEKMRKSLVEAVQRVGGREIHATIPETGLTHRIRALFENAIRTDKGSQCPLLWRMYMHFLVSLGNKERSKGVFYKALQNCPWAKVLYMDAMEYFPDELQEILDLMTEKELRVRLPLEELELLLED"
     misc_feature    1039..2037
                     /gene="Nrde2"
                     /note="NRDE-2, necessary for RNA interference; Region:
                     NRDE-2; pfam08424"
                     /db_xref="CDD:285605"
ORIGIN      
gaaccacatttcccagagtgcacggcgagatagcggcctaggcagcgctcgccggccggcgccatttccatggagggagcggaggtgcggccagtgagcatggcgctgttcccggcctttgcaggtgttagtgaggccgccggtagtggggactccaggagagaattagactggctcagcaacccaagcttttgtgttggcaacttaacatcactgagccaacaaactgaagaggccccagcccttgcttctggagggtcaccgctgaaaaggagtcctctacaatcagagctctccgatgatagtgactctagcaagaagctcacacagataagcagaaaaaagaagaaagagagaaagaaaaaaaggaagcatcagcaccggaagaaaacaaaaaagaaacacgagcagtccagtactactgggtctgagtcggattcggatttgggaaaggacaggtcttccagaaccctcggtagtcagaaggaatctgagaaacccaacagtcaaggacataatgctgctgctgatacaggacattgctccatttggttggaagacattcagagtttgacaggagaagtcttcagaacagataaaaaaccagatcctgccaactgggagtacaagtctctgtaccgaggggatatcgcaagatacaagcggaaaggagactcctgcctgggtattaaccctaagaagcagtgtatatcttgggaaggggcttctgcagcaaagaggcgctcacacaagcaactggagcgttattttaccaagaagaatgtgggattgatgagcatcgatggaatggctgtgagcagtaatgctgagcctctgtcctctgagccagccacctttattccagtgagggactctgctgatgtggctgttcctggtaccacatggttgaatcctctggggatttatgatcagtcaaccacacagtggttacaaggacagggtccaacagagcaagaatccaagcagccagactcacaagaagacagggagagagctgttcttaaggccagagtagaggagtttaacagaaaggttcgggagaatcctcgggacactcagctgtggatggcatttgtggcttttcaggacgaggtgatgaggagccctggcctgtatgcccttgaggaaggcgagcaggagtggcggaagaagtccctgaagctcctcctggagaagaagctggcagtgctggagcgggccattgagagcaacccgagcagcatggacctgaagctggccaagctgaagctctgcgctgagttctgggagccctccatgcttgtcaaggagtggcagaaactgatcttcttacaccccaataacacagccctgtggcagaaatatcttttgttttgccagagccagttcagcaccttttcaatatcaaaaattcacagtttgtatggcaaatgcttgagcactttatctgccgtgagggatggcagcatcttgtctcaccctgcggagcctggcacggaagacgccatgtttgtgctctttcttcagcagtgccactttctgcggcaggctggccactcggagaaggtcatctctttgttccaagccatggttgacttcaccttcttcaagcctgacagtgtgaaagagctgcctactaaagtacaggtagaattctttgaacccttctgggatagtggtgagccccgggctggggagaagggagcccgaggctggcgagcatggatgcaccagcaggagcggggtggctgggtggtcgtcaaccaagacgaggatgatgatgagccagaagaggaagaacaggagataaaagacaagactctgcccaggtggcagatctggcttgctgctgaacgttctcgagaccagaggcactggcagccttggtgtcctgataagaccaagaagcaaactgaggatgactgtgaggatcctgagagacaggtgttgtttgacgatataggacagtctctgatcagactttgcagcccagatcttcagttccagctgatcgaggcctttctgcagttcttgggtgtgccttctggcttccttcctccagcctcctgcctttacctggccatggacgagagcagtgtctttgatagtggactctatgatgaaaagcccttgactttcttcgacccttccttttctggcatcagctgtgttggccacatgaatcagctgggttgtcctcgatggaccaggggtcacaaccgagagggcgaggagtttgtccgcaacatcttccaccttgtgctgcctttgttctcaggcaggcggaagtcccagctctgcttctcctggttacggtacgagattgccaaggtcatttggtgtctgcacactaaaaagaagaaattaaagtcgcaggggaagaactgcaaaaaactagccaagaatctcctcaaggagccagaaaaccgaaacaacttttgcctctggaagcagtatgcatacctggagtggttgcttggtaacatagaggatgccagaaaagtgtttgatacagcactcagcatggcaggcagcagtgagctgaaggaccgagaactctgtgaacttggtctgctctatgccgagctggaggtggaagtgtcaccggacttgcgaggggctgccacaggccgagcagtccacatactaactcggctgactgagaacagtccctatgggtcctacactgggcaggtcttggctactcatgttctgaaagcccgaaaggcttatgaccacgcgctgcaggactgtctgggtgcgagcggtgcctctggcccggctcctgcagagtctttggactgcctgagcagcttggtcaaatgctttatgctcttccagtatttgactgtagggatcgatgctgctgtgcagatttatgagcaggtatttgccaacctgaagggctctgttctcccagaaggccctggggaggagaactcccagagtttgaccagcgttctcgaagcagtcaccctgatgcacacaagtctgctgagattccacatgaaagttagcccttaccctctaactccacttcgagagacgctctcggaggctttaaagctctatccaggcaatcaggttctttggagggcatatgtacagattcagagtaagtcccatagtgctaacaagaccagaagattctttgatgcagtcaccaggtctgccaaacccttggagccttggttgtttgcaattgaagctgagaaaatgaggaaaagcctggtggaagctgttcagagggtaggtggtagagagatccatgctaccatccctgagactggccttactcatcggatcagagccctgtttgaaaatgcaattcggactgataagggcagccagtgccccttactgtggaggatgtatatgcattttttggtttccttaggaaacaaagaaagaagcaaaggtgtattttacaaggcacttcagaactgcccttgggcaaaggtgctgtacatggatgccatggagtacttcccggatgagctgcaggagatcctggatctgatgactgagaaggagctccgggtgcgcctgcccctggaggagctggagctcctgctggaggactagtgtgtggtggggctgcaccagtctgaggagcagagcaggatcagggggagccacggctcatgagatcattttccattatttgtgtctgggtggtgagccccacctatctggcacaggttttagatgcattgttttacatatcatatatgtgactatatgtacatgtgtacagatgaataatcatgctagtgataaacatttttgtttgaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]