GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 15:19:56, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XM_008675212            5456 bp    mRNA    linear   PLN 18-DEC-2017
DEFINITION  PREDICTED: Zea mays homeobox 3 (hox3), transcript variant X1, mRNA.
ACCESSION   XM_008675212
VERSION     XM_008675212.3
DBLINK      BioProject: PRJNA249074
KEYWORDS    RefSeq.
SOURCE      Zea mays
  ORGANISM  Zea mays
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; PACMAD
            clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae;
            Zea.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_024461.2) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Dec 18, 2017 this sequence version replaced XM_008675212.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Zea mays Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5456
                     /organism="Zea mays"
                     /mol_type="mRNA"
                     /cultivar="B73"
                     /db_xref="taxon:4577"
                     /chromosome="3"
                     /tissue_type="seedling"
                     /country="USA"
     gene            1..5456
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="homeobox 3; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 1 mRNA, 46 ESTs, 187 long
                     SRA reads, 4 Proteins, and 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 283
                     samples with support for all annotated introns"
                     /db_xref="GeneID:542440"
     CDS             461..5194
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /codon_start=1
                     /product="homeobox 3 isoform X1"
                     /protein_id="XP_008673434.1"
                     /db_xref="GeneID:542440"
                     /translation="
MGRKGSEVSPSKRYPLRSAHSSGRVLRSALANNNKDSEPLNAAAATQAAVKKRSGNQLDSPNSTVRLLRSTSKNKDEAHSGPLNDRIIDKPAANKRKHANPSQVGSPSSSVRVLRSAIKNKDMARSEPQSDRTAGEAATNKRKNANSSKVGSLSSGLSVLRSASKAKDETCIKPLNDSAAVEPASSKRKCTSPSKVGSPSNSVRVLRSTSKYKNETCTEPLNDSGAVEPAANRRKGVSRSKEGSPNSSVRVLRSASNNKIDVSIEPLNNSTTGQPAAKRRKNGSSFKSSARVLCSTSERANEASSEPLNDSTAAQPAARKKKGGAMPKTDNPKIGVRVLRSASGKKNETCTEPVNGSTSAEPTVTKKRNCKPSKDRSPKKDYLKICQRIKYILNRMKYEQAFIQAYASEGWKGQSLEKIRPEKELERAKAEILQCKLRIREAFRNMDSLLSKGKLEESLFDSAGQISSEDIFCAICGSKDVTSQNDIILCDGACDRGFHQNCLSPPLLTEEIPPGDEGWLCPACVCKADYIDALNELQGSKLSIHDSWVKVFPEAASTANGSKQVDASDLLPDHIKDSANLALVGTHMVNEIRFSEEDDSKADDLGLPSEDSGDGDFDPAGPDSSEDQNDGLNSEESDFTSDSDYFCAEIAKSCGQDEVSASPLSNVINRTDRMKLRAYSRRSNEENHNHAFMDMELEQDIVLPVPSRRQVERLDYKKLYDEAYEEESSNSSDEEEWSGKELLEGSGTDSLDERLRPVKRCSRRAPAGQQNNELTPQSRPHGSNSEQKTEVLRSNGSSSTGRKYDPEVTQKLKVHFEKDPYPSRETKENLSEELGLTFNQVSKWFSSTRHYSRVASAKKEMHPDSHTCENNDETTVDSMQAKQPNAGVMEKLTGDRNGIVPEKPMVQDNLNQGAMEKLTRDKNDIVPEKPVMQSSLNQCNNEDIPLSGTEIEMESYEQESSDSSDEEWSILSTPRKTRLQDHGKSSVTESLRSAKRCSRRAPAREQNNERIQSEQLHGSASEQQTEFLRSNVSSGKVSKYHFGPIVSQKLKEHFEKDPYPCRATKESLAQELGLTFNQISKWFSGTRHYSRDAVAKNQKRPGENTTVNNNSTTFDDIQVIEPNVGLIDKPAADVNDMISEKLMVQINLNEGIEEDIPPSQYARCEEKITMTPAAISREAGLPGYGPGPGENFLQVSSRNTSCEQSVILAPTAIAREVGPPGYATGENQGNGAPWNTSYERRLFMNPVTSSRAVSPPGYGPEESRGSGISWNTSSEQILFMSPTTISRELGPPGYGPREDQCSGTSWNASCELGVFMSPVTTSREDSPPGYGPRENQENDNMRCELRMFTSPTTISREVGPPGYELTGKNKGNGASCTTNYQQGAFTSPEAFPREACPPGFVSGENQGNDTPWYMSSKQMAFTSPTTNPRVGPPGYGQENQGSRVSWNTSYEQGVFMSSTNISREAGPPGYGPGESQGNITSWISTGGQRMFTGPSTIPNEVGQQGYGPSGIPGTDGSRSMDLKAFPPGYGPAGENQGGGASGSVISPQARSAENVEFSDDARKKAIQRELRRRQKFR"
     misc_feature    1874..2032
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="PHD finger found in Arabidopsis thaliana
                     pathogenesis-related homeodomain protein (PRHA) and
                     similar proteins; Region: PHD_PRHA_like; cd15504"
                     /db_xref="CDD:276979"
     misc_feature    order(1874..1876,1916..1930,1943..1945,2015..2017)
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="putative histone H3 binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:276979"
     misc_feature    order(1877..1879,1886..1888,1928..1930,1940..1942,
                     1955..1957,1964..1966,2021..2023,2030..2032)
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:276979"
     misc_feature    2864..3019
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(2867..2869,2987..2989,2996..3001,3008..3010)
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    3575..3733
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(3581..3583,3701..3703,3710..3715,3722..3724)
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    <4028..>4741
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="Epstein-Barr virus nuclear antigen 3 (EBNA-3);
                     Region: EBV-NA3; cl27975"
                     /db_xref="CDD:332796"
     misc_feature    4559..>5107
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="ARC105 or Med15 subunit of Mediator complex
                     non-fungal; Region: Med15; pfam09606"
                     /db_xref="CDD:312941"
ORIGIN      
aatcttggttcatcaaagtaaaaaaggcagaaaacagacacgatgacatctgtttttgacgccttgattaaacacgtggccagcggcctgctacagcctactgcctacagatgcaaatcagtaccaggcgtgctctccgtgagctctacgcctctacctgtgtcttggcgacgactgggcgaccgacgacgcagccgtaggacaggcgaccgacgacgcagccgtaggataggcgaccaggtcttcctgttggctcttgcccttcgccggcgacgagcacccgccaggtcttgacacatctatcttgactggataacttaccttgttaatgaaggtttctctgatattccggtggcctagcagttactgtggaggatattcatttgtgtttatcatttatttggtcttgttcagggccacaacgacattgggaacaagtgtatgacatacaaacagtaaaatgggaaggaaagggtcagaagtatcaccaagcaaaaggtatcccttgaggtctgcacatagtagtggtagagttcttcgctctgccttagccaataataataaggacagtgagcctctgaatgcggctgctgctacccaagcagctgtgaaaaaaagaagtggcaaccagctagatagtcctaatagcactgtcaggctacttcgttctacatcaaaaaataaggacgaggcacatagcgggcctctaaatgacaggatcattgataagccagctgcaaataaaagaaaacatgccaatccctcacaggttggaagtcccagcagcagtgtcagggtgcttcgctctgcaataaaaaataaagatatggcgcgcagtgagcctcaaagtgacaggaccgctggtgaggcagctacaaataaaagaaaaaacgccaattcctcaaaggtggggagtctgagctctggtctcagtgtgcttcggtctgcttcaaaagctaaggatgagacatgtatcaaacctttaaatgatagtgctgctgttgaaccagcttcaagtaaaagaaaatgcaccagtccgtcaaaggtgggaagtcccagcaacagtgtcagggtgcttcgatctacttcaaaatataagaatgagacatgtaccgagcctttaaatgatagtggtgctgttgaaccagctgcaaatagaaggaaaggtgtcagtcgttcaaaggagggaagtcccaatagcagtgtcagggtgcttcgctctgcctcaaataataagattgatgtatctattgagccactaaataatagtactactggtcaaccagctgcgaaaagaagaaagaatggcagttcctttaagagcagtgccagggtgctttgctctacctcagaaagggcaaatgaggcatctagtgagcctttaaatgatagtactgctgctcagccagctgcgaggaaaaagaaaggtggtgcaatgccaaagactgataacccaaagattggtgtcagggttcttcgctctgcctcaggaaagaagaatgagacatgtactgagcctgtaaatggcagtacttctgctgaaccaactgtgacaaaaaaaagaaattgcaagccttcaaaggatcgcagtcccaagaaggactacttaaaaatttgtcaaagaattaaatatattttgaatcgaatgaagtatgaacaagcctttattcaggcttatgcaagtgaaggttggaaaggccaaagtttggaaaaaataagacccgagaaggagcttgaacgagccaaggcagaaatccttcaatgcaagttaagaatccgggaagcttttcgaaatatggactctcttttatcgaaggggaagcttgaagaatctttgtttgattcagcaggacaaatttcaagcgaagatatattttgtgccatatgtggctcaaaggatgttacttcacaaaatgacatcattctttgtgatggagcctgtgacagaggattccaccagaattgtttgagccctcctttgctaactgaagaaattcctccgggggatgaaggatggctttgccctgcatgtgtgtgcaaagcagactatatagatgcgttaaatgaacttcaaggaagcaaactctccattcatgactcatgggtgaaagttttccctgaggcagcttcaactgccaatggttctaaacaagttgatgcttctgatctgctgccagatcatataaaggacagtgctaaccttgcattggttggaacgcacatggtgaatgaaatcaggttttctgaagaggatgatagcaaagcggatgacctcggcttgccttcggaggactcaggggatggtgacttcgatccagcaggtccagattctagtgaagaccaaaatgatggattgaactcagaagagtcagatttcacatctgactctgattatttttgtgctgagattgctaaatcttgcggccaggatgaagtctcggcatctccattatcaaatgtgataaaccgtactgatagaatgaaactcagggcctacagtagacgctctaatgaagaaaaccacaatcatgcatttatggacatggagctagagcaagacatagtgctaccagttccaagcaggcggcaggttgaacggttggattacaaaaaactatacgatgaggcatatgaggaagaatcatctaattcaagtgatgaagaagagtggtctggaaaagaactcttagaaggcagtggaacagattcacttgatgagcgacttcgtcctgtaaaacggtgctctagaagagcaccagcagggcagcagaataatgaacttacaccacagagccggcctcatggttctaacagtgagcagaaaactgaagttcttcgctccaatggcagtagtagcacaggacggaagtatgatcctgaagttacccagaaattgaaggtgcattttgagaaagatccatatcctagccgtgaaacaaaagaaaatctatcagaagaactaggcttgacatttaatcaggtctccaaatggttctctagtactcgtcactattcaagggttgcttctgccaaaaaagaaatgcatcctgacagccatacttgtgagaataatgatgagacaactgtagacagcatgcaagcaaaacaacccaatgctggggtgatggaaaagttgacgggggatagaaatggcattgttcctgagaaaccgatggtgcaggacaatcttaaccaaggagcgatggaaaagttaactagggataaaaatgacattgttcctgagaaaccggtgatgcagagcagtcttaaccaatgtaataatgaagatataccgctttctggaacagaaattgagatggagtcttacgaacaagaatcatctgactcaagtgatgaagagtggtccatacttagcacaccacgaaaaacaagattacaagaccatggaaaatcatcagttactgaatcacttcgttctgcaaaacggtgttccagaagagcaccagctagggagcagaataatgaacgtattcagagtgagcagcttcatggttctgcaagtgagcagcaaactgaatttcttcgctccaatgtcagcagtggcaaggtctcaaaatatcattttggccctatagttagtcagaagcttaaggaacattttgaaaaagatccatatccttgccgtgcaacaaaagagagtctggcacaagagctaggactgacatttaatcagatcagtaagtggttctctggcactcgtcattattcaagagatgctgttgccaagaatcagaaacgcccgggagaaaatactactgtgaataataatagcacaacctttgatgacatacaagtaatagaacccaatgttgggttgatagataaaccagctgcagatgtaaatgacatgatttctgaaaagttgatggtccaaataaatcttaacgaaggcattgaagaagatatcccaccgagccaatatgccaggtgtgaagagaaaataactatgactccagctgccatctcaagggaagctggtcttccaggatatggtcctggtcctggagaaaactttcttcaggtcagttcaaggaatactagctgtgagcagagtgtgatactggctcctaccgctatcgcaagagaagttggtccaccaggatatgcgactggagaaaaccagggcaatggggctccatggaatacaagttatgagcgaagactatttatgaatcctgtgaccagctcaagagcagtcagtcctccaggatatgggcctgaagaaagccgaggcagtggcatttcctggaatacaagcagtgaacaaatattgtttatgagtcctacaaccatctcaagagaacttggtccaccaggatatgggcctagagaagaccagtgcagtggcacttcatggaatgcaagctgcgagttgggagtatttatgagtcctgtgaccacctcaagagaagacagtccgccaggatatgggcctcgagaaaaccaggagaatgacaatatgagatgcgagttgagaatgtttacaagtcctacaaccatctccagagaagttggcccaccaggatatgagcttactggaaaaaacaagggcaacggcgcttcatgtactacgaattaccagcagggagcgtttacgagtcctgaagccttcccaagagaagcctgtcctccaggatttgtgtctggagagaaccagggtaacgacactccatggtatatgagcagcaaacagatggcgtttacgagtcctacgaccaaccctagagtaggtccgccagggtatggacaggaaaaccagggcagtcgtgtttcttggaatacgagttatgagcagggagtgtttatgagttctacaaacatctcaagagaagccggtccgccaggttatgggcctggggaaagtcagggcaatatcacttcatggatttcgacaggcgggcagagaatgtttacaggtccttcaactatcccgaacgaagtcgggcagcaaggatatggcccttcaggaatcccgggaacggatggctcaaggagtatggacttgaaagcctttccaccaggatatggacctgctggagaaaaccagggcggtggtgcttcagggagcgtcataagcccccaagctcggtctgcagagaacgtagagttttcagacgacgctagaaaaaaggctatacagcgggagctgagacggcggcagaagttcaggtgatggccgtgatgcgaatttctgatcttgctcatcgaattttgactacggattactactttttaagactacatatccagtcttgatggctgaatgagtgacgaccctagttgtcgagacgcaaaaccttttgttgtatgtgttccttttacagacttccttggcttgtcatgaatttctaatgtgaacttgtgctgtgaacttgttgcaaaacctcttgaacctgaagcattcaacatgatgtgagcttgtgcagttactcttc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]