ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-17 19:32:09, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_008431052 1259 bp mRNA linear VRT 05-JUN-2025
DEFINITION PREDICTED: Poecilia reticulata C-type lectin domain family 4 member
G-like (LOC103477754), mRNA.
ACCESSION XM_008431052
VERSION XM_008431052.2
DBLINK BioProject: PRJNA232869
KEYWORDS RefSeq.
SOURCE Poecilia reticulata (guppy)
ORGANISM Poecilia reticulata
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
Acanthomorphata; Ovalentaria; Atherinomorphae; Cyprinodontiformes;
Poeciliidae; Poeciliinae; Poecilia.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_024346.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
On Jun 21, 2016 this sequence version replaced XM_008431052.1.
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Updated annotation
Annotation Name :: GCF_000633615.1-RS_2025_05
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.4
Annotation Method :: Best-placed RefSeq; Gnomon;
tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 05/30/2025
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..1259
/organism="Poecilia reticulata"
/mol_type="mRNA"
/strain="Guanapo"
/isolation_source="inbred female from a population that
was originally collected from the Guanapo drainage in
Trinidad in 2010"
/db_xref="taxon:8081"
/sex="female"
/linkage_group="LG16"
gene 1..1259
/gene="LOC103477754"
/note="C-type lectin domain family 4 member G-like;
Derived by automated computational analysis using gene
prediction method: Gnomon. Supporting evidence includes
similarity to: 2 Proteins, and 100% coverage of the
annotated genomic feature by RNAseq alignments, including
4 samples with support for all annotated introns"
/db_xref="GeneID:103477754"
CDS 25..1167
/gene="LOC103477754"
/codon_start=1
/product="C-type lectin domain family 4 member G-like"
/protein_id="XP_008429274.1"
/db_xref="GeneID:103477754"
/translation="
MKTANQQESIKTLITDRRQLIEEQKMMENEMEEVVRDRHLSLEKAGFIQKRLTQVREELNKERDELRNKIDELSREKDELSRKNDELSNEKDEPNDEKDELNKERDELSRKTEELSKERDELRNKINELSREKDELSRKNDELNNEKDELSRKTEELSKERDRLSEDKHELRQEKDKLNKEKKDLSTEKEELKKEREKLRVLTDQAEKRCRERDALKNFYDALMKFDNFPVRDLCPVSLRPKCQHCAKHEKSYKGHCYYIYPYDIGYANWDRSRQLCKTEGGDLVVIDDLEEQEFINNHTQKYDSDNHGYWIGLHHFRHNWSWVDGRRNFLEFWIEGIPRSSGAALHMPRQKATESWRAEDKMEASKFICERLEISWPFG"
misc_feature <40..>693
/gene="LOC103477754"
/note="chromosome segregation protein SMC, common
bacterial type; Region: SMC_prok_B; TIGR02168"
/db_xref="CDD:274008"
misc_feature 760..1137
/gene="LOC103477754"
/note="C-type lectin (CTL) or carbohydrate-recognition
domain (CRD); Region: CLECT; smart00034"
/db_xref="CDD:214480"
misc_feature order(1057..1059,1063..1065,1072..1074,1090..1092,
1096..1107,1114..1122)
/gene="LOC103477754"
/note="ligand binding surface [chemical binding]; other
site"
/db_xref="CDD:153057"
ORIGIN
ctaatttgtgtttttatagtgaatatgaagacagccaatcagcaggaaagtatcaaaacccttataacagatagaagacaacttattgaggaacaaaagatgatggagaacgagatggaggaggtggtccgagacagacacctgagcctagaaaaagctgggtttatccaaaagaggctaactcaagtcagagaggagctgaacaaagagagagacgagctgaggaataagattgacgagctgagcagagagaaagatgagctgagcagaaagaacgacgagctgagcaatgagaaagacgagccgaacgatgagaaagacgagctgaacaaagagagagacgagctgagcaggaagacagaggagctgagcaaagagagagacgagctgaggaataagattaacgagctgagcagagagaaagatgagctgagcagaaagaatgacgagctgaacaatgagaaagatgagctgagcaggaagacagaggagctgagcaaagagagagacaggctgagtgaagacaaacacgagctgagacaggagaaagacaaactgaacaaagagaaaaaggatctgagcacagagaaagaggagctgaagaaagagagagagaagctgagagtattgacagaccaggcagagaagcgatgcagagagagagatgctctgaaaaacttttatgatgccctcatgaaatttgacaattttccagttcgtgatttgtgcccagtatcgttgagaccgaaatgccagcattgcgccaaacatgagaaatcctacaagggacactgctactatatttatccatatgacataggttatgcaaactgggaccgaagtcgacagttgtgtaagactgaaggtggagacttggttgtaattgatgatctggaggagcaggaatttatcaacaatcacacccagaaatacgattctgataaccatggatactggatagggttacatcactttcgacacaattggtcctgggttgatggacgtaggaactttcttgagttctggattgaggggattccccgttcgtcaggagcagcgctgcatatgccacgacaaaaagccacagagagctggagagcagaagacaagatggaagcatccaaattcatctgtgagcgtctggagatttcttggccctttggctaacactgttctcttaaagcttcaatcaagaatactcagcgtgtcatcacattttggtgaatgtcataaataaaagctcaatctctgaaagccaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]