2025-09-18 17:12:37, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_008431052 1259 bp mRNA linear VRT 05-JUN-2025 DEFINITION PREDICTED: Poecilia reticulata C-type lectin domain family 4 member G-like (LOC103477754), mRNA. ACCESSION XM_008431052 VERSION XM_008431052.2 DBLINK BioProject: PRJNA232869 KEYWORDS RefSeq. SOURCE Poecilia reticulata (guppy) ORGANISM Poecilia reticulata Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Ovalentaria; Atherinomorphae; Cyprinodontiformes; Poeciliidae; Poeciliinae; Poecilia. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_024346.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Jun 21, 2016 this sequence version replaced XM_008431052.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_000633615.1-RS_2025_05 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.4 Annotation Method :: Best-placed RefSeq; Gnomon; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 05/30/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1259 /organism="Poecilia reticulata" /mol_type="mRNA" /strain="Guanapo" /isolation_source="inbred female from a population that was originally collected from the Guanapo drainage in Trinidad in 2010" /db_xref="taxon:8081" /sex="female" /linkage_group="LG16" gene 1..1259 /gene="LOC103477754" /note="C-type lectin domain family 4 member G-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 4 samples with support for all annotated introns" /db_xref="GeneID:103477754" CDS 25..1167 /gene="LOC103477754" /codon_start=1 /product="C-type lectin domain family 4 member G-like" /protein_id="XP_008429274.1" /db_xref="GeneID:103477754" /translation="
MKTANQQESIKTLITDRRQLIEEQKMMENEMEEVVRDRHLSLEKAGFIQKRLTQVREELNKERDELRNKIDELSREKDELSRKNDELSNEKDEPNDEKDELNKERDELSRKTEELSKERDELRNKINELSREKDELSRKNDELNNEKDELSRKTEELSKERDRLSEDKHELRQEKDKLNKEKKDLSTEKEELKKEREKLRVLTDQAEKRCRERDALKNFYDALMKFDNFPVRDLCPVSLRPKCQHCAKHEKSYKGHCYYIYPYDIGYANWDRSRQLCKTEGGDLVVIDDLEEQEFINNHTQKYDSDNHGYWIGLHHFRHNWSWVDGRRNFLEFWIEGIPRSSGAALHMPRQKATESWRAEDKMEASKFICERLEISWPFG"
misc_feature <40..>693 /gene="LOC103477754" /note="chromosome segregation protein SMC, common bacterial type; Region: SMC_prok_B; TIGR02168" /db_xref="CDD:274008" misc_feature 760..1137 /gene="LOC103477754" /note="C-type lectin (CTL) or carbohydrate-recognition domain (CRD); Region: CLECT; smart00034" /db_xref="CDD:214480" misc_feature order(1057..1059,1063..1065,1072..1074,1090..1092, 1096..1107,1114..1122) /gene="LOC103477754" /note="ligand binding surface [chemical binding]; other site" /db_xref="CDD:153057" ORIGIN
ctaatttgtgtttttatagtgaatatgaagacagccaatcagcaggaaagtatcaaaacccttataacagatagaagacaacttattgaggaacaaaagatgatggagaacgagatggaggaggtggtccgagacagacacctgagcctagaaaaagctgggtttatccaaaagaggctaactcaagtcagagaggagctgaacaaagagagagacgagctgaggaataagattgacgagctgagcagagagaaagatgagctgagcagaaagaacgacgagctgagcaatgagaaagacgagccgaacgatgagaaagacgagctgaacaaagagagagacgagctgagcaggaagacagaggagctgagcaaagagagagacgagctgaggaataagattaacgagctgagcagagagaaagatgagctgagcagaaagaatgacgagctgaacaatgagaaagatgagctgagcaggaagacagaggagctgagcaaagagagagacaggctgagtgaagacaaacacgagctgagacaggagaaagacaaactgaacaaagagaaaaaggatctgagcacagagaaagaggagctgaagaaagagagagagaagctgagagtattgacagaccaggcagagaagcgatgcagagagagagatgctctgaaaaacttttatgatgccctcatgaaatttgacaattttccagttcgtgatttgtgcccagtatcgttgagaccgaaatgccagcattgcgccaaacatgagaaatcctacaagggacactgctactatatttatccatatgacataggttatgcaaactgggaccgaagtcgacagttgtgtaagactgaaggtggagacttggttgtaattgatgatctggaggagcaggaatttatcaacaatcacacccagaaatacgattctgataaccatggatactggatagggttacatcactttcgacacaattggtcctgggttgatggacgtaggaactttcttgagttctggattgaggggattccccgttcgtcaggagcagcgctgcatatgccacgacaaaaagccacagagagctggagagcagaagacaagatggaagcatccaaattcatctgtgagcgtctggagatttcttggccctttggctaacactgttctcttaaagcttcaatcaagaatactcagcgtgtcatcacattttggtgaatgtcataaataaaagctcaatctctgaaagccaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]