GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 01:24:10, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_007703738             846 bp    mRNA    linear   PLN 06-FEB-2020
DEFINITION  Bipolaris sorokiniana ND90Pr uncharacterized protein
            (COCSADRAFT_173037), partial mRNA.
ACCESSION   XM_007703738
VERSION     XM_007703738.1
DBLINK      BioProject: PRJNA245122
            BioSample: SAMN02981285
KEYWORDS    RefSeq.
SOURCE      Bipolaris sorokiniana ND90Pr
  ORGANISM  Bipolaris sorokiniana ND90Pr
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae;
            Pleosporaceae; Bipolaris.
REFERENCE   1  (bases 1 to 846)
  AUTHORS   Ohm,R.A., Feau,N., Henrissat,B., Schoch,C.L., Horwitz,B.A.,
            Barry,K.W., Condon,B.J., Copeland,A.C., Dhillon,B., Glaser,F.,
            Hesse,C.N., Kosti,I., LaButti,K., Lindquist,E.A., Lucas,S.,
            Salamov,A.A., Bradshaw,R.E., Ciuffetti,L., Hamelin,R.C., Kema,G.H.,
            Lawrence,C., Scott,J.A., Spatafora,J.W., Turgeon,B.G., de Wit,P.J.,
            Zhong,S., Goodwin,S.B. and Grigoriev,I.V.
  TITLE     Diverse lifestyles and strategies of plant pathogenesis encoded in
            the genomes of eighteen Dothideomycetes fungi
  JOURNAL   PLoS Pathog. 8 (12), E1003037 (2012)
   PUBMED   23236275
REFERENCE   2  (bases 1 to 846)
  AUTHORS   Condon,B.J., Leng,Y., Wu,D., Bushley,K.E., Ohm,R.A., Otillar,R.,
            Martin,J., Schackwitz,W., Grimwood,J., MohdZainudin,N., Xue,C.,
            Wang,R., Dhillon,B., Tu,Z.J., Steffenson,B.J., Salamov,A., Sun,H.,
            Lowry,S., LaButti,K., Han,J., Copeland,A., Lindquist,E., Lucas,S.,
            Barry,K., Schmutz,J., Baker,S., Grigoriev,I.V., Zhong,S. and
            Turgeon,B.G.
  CONSRTM   US DOE Joint Genome Institute (JGI-PGF)
  TITLE     Comparative genome structure, secondary metabolite and effector
            coding capacity across Cochliobolus pathogens
  JOURNAL   Unpublished
REFERENCE   3  (bases 1 to 846)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (06-FEB-2020) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   4  (bases 1 to 846)
  AUTHORS   Ohm,R.A., Otillar,R., Martin,J., Schackwitz,W., Grimwood,J.,
            Salamov,A., Sun,H., Lowry,S., LaButti,K., Han,J., Copeland,A.,
            Lindquist,E., Lucas,S., Barry,K., Schmutz,J., Condon,B.J., Leng,Y.,
            Wu,D., Bushley,K.E., MohdZainudin,N., Xue,C., Wang,R., Dhillon,B.,
            Tu,Z.J., Steffenson,B.J., Baker,S., Zhong,S., Turgeon,B.G. and
            Grigoriev,I.V.
  CONSRTM   US DOE Joint Genome Institute (JGI-PGF)
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2012) US DOE Joint Genome Institute, 2800
            Mitchell Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_006911904).
            
            ##Metadata-START##
            Organism Display Name :: Cochliobolus sativus ND90Pr
            GOLD Stamp ID         :: Gi04490
            ##Metadata-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..846
                     /organism="Bipolaris sorokiniana ND90Pr"
                     /mol_type="mRNA"
                     /strain="ND90Pr"
                     /db_xref="taxon:665912"
                     /chromosome="Unknown"
     gene            <1..>846
                     /locus_tag="COCSADRAFT_173037"
                     /db_xref="GeneID:19132821"
     CDS             1..846
                     /locus_tag="COCSADRAFT_173037"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_007701928.1"
                     /db_xref="GeneID:19132821"
                     /db_xref="JGIDB:Cocsa1_173037"
                     /translation="
MPNETCDYGDLKVTLTSDLQWMWNEKDTGGDLYGEATLLVGNASKGSEKPAVASPTGYTKIWTGRGSGGKYDGSFWRPIAPSRYVALGYICISNNNTPSVNYMYTEEIEKIAVLDDLYRANSNYEMPPVGLARILGLPCPKDFNEFRAKIPQFTKDNLLIASQMFSELPQCEVILTFTAFFAVTDRANLGVSISASVGIKAIGGGVDVSLNYQFTSKTSSSYGEYSEYTHEQRYTIAPRTATILLSERVWMQATRSDDSVSLREISFTSTDNTNRVEASFE"
     misc_feature    112..>309
                     /locus_tag="COCSADRAFT_173037"
                     /note="Vacuolar protein sorting-associated protein 62;
                     Region: Vps62; pfam06101"
                     /db_xref="CDD:428768"
     misc_feature    <565..>804
                     /locus_tag="COCSADRAFT_173037"
                     /note="pore-forming module of aerolysin-type beta-barrel
                     pore-forming proteins; Region: PFM_aerolysin_family;
                     cl40431"
                     /db_xref="CDD:394801"
ORIGIN      
atgcccaacgaaacttgcgactatggtgacctgaaggtcacgcttacaagtgatctgcaatggatgtggaacgagaaggacactggaggcgacctatacggcgaagctacgctcttggttggaaacgcctccaaaggttctgagaagccagccgttgcaagtccaactggttacacaaagatctggaccggtcgcggcagtggcggcaagtacgacggctctttctggaggccgatagctccttctagatacgtcgcgttaggatatatctgcatcagtaataataatactccatcagtcaactatatgtatacagaagagatcgagaagatcgcagtccttgatgatctatacagggccaactccaactatgaaatgcctcccgtcggactcgctaggatcctaggactgccatgcccaaaggacttcaatgaattcagggcaaagataccccaattcaccaaggacaaccttctcattgctagccagatgtttagcgagctgccacagtgcgaggtcatactgaccttcactgcgttcttcgcagtaacagatagggcgaacttgggggtgtccatctcagcatccgttggaatcaaggctataggtggaggtgtagacgtcagtctcaactaccaatttacgtcgaaaacgtcctcttcgtacggtgaatactcagagtatacccacgagcaacgttacaccattgcaccgcgtacggctactatactcctaagtgagcgtgtgtggatgcaggctacgcgcagtgatgattcggtgtctctacgggaaatcagtttcacctccaccgataatacgaacagggttgaagcttcattcgaatga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]