GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 05:26:50, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XM_006795275            4831 bp    mRNA    linear   VRT 24-AUG-2020
DEFINITION  PREDICTED: Neolamprologus brichardi testis and ovary specific PAZ
            domain containing 1 (topaz1), transcript variant X2, mRNA.
ACCESSION   XM_006795275
VERSION     XM_006795275.1
DBLINK      BioProject: PRJNA232513
KEYWORDS    RefSeq.
SOURCE      Neolamprologus brichardi
  ORGANISM  Neolamprologus brichardi
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Ovalentaria; Cichlomorphae; Cichliformes;
            Cichlidae; African cichlids; Pseudocrenilabrinae; Lamprologini;
            Neolamprologus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_006272037.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Neolamprologus brichardi Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4831
                     /organism="Neolamprologus brichardi"
                     /mol_type="mRNA"
                     /isolate="N.brichardi 1_Salsburger"
                     /db_xref="taxon:32507"
                     /chromosome="Unknown"
                     /sex="female"
     gene            1..4831
                     /gene="topaz1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:102791996"
     CDS             131..4831
                     /gene="topaz1"
                     /codon_start=1
                     /product="uncharacterized protein topaz1 isoform X2"
                     /protein_id="XP_006795338.1"
                     /db_xref="GeneID:102791996"
                     /translation="
MFPSSSRVKLNRVALKDVVGLKLTPRRRRVPKLPNRISAESKKQEKNSDSVQLMSQKDMVSPPGSNEPDQNLTHTMGFEKKTQAPSTHDEEEPEENGSDVDRHKEPNLSGLAGSEVLLRRAVGASHCGLCGECKYTSPQLKAPGKLKRASPASEPPAAQSEIEKENTITQSSKKIIVWINQYPKVILCDVAKKCEACGHDCGYVLPDALENKVVRCFQQEMRASLRFWPTCLRHNESETEKKALFKSSKCCPSAQDEKTVCQSQSLIRQNHLDEGMHSQPLSHHAVSPFHRSQTGEDSATCSASFLLDEHTKTGNCRGGMRDRDAEVDHGPGSDPVSPETCREKGKVGDSIECSSTLDFAPTDKCCASGGQKGDPTNADGSHVLSDLIDHVSDEDTDAPESYTCQRVKAYLRKIHFSCARTYMAWPFSKTCTANASATAGTIDPSAKDGIDSATANQSMPGSSGNLFKDIPPKAPTEKWEEDGESAFAQGNAKRHRKDMETSPLFNQPEESETRPNSDTASFPPPAQCGRERGTDGVSASALLVNGPETVTSISTPSPSVLSLSDWDTATTLSLMSSPFTQGSMSSLSATTSSLPPSSFIPKRVNVADKILSSCEEAQTASSSPNVPLHTPDSFHSCESSVLPQDEHENDKERFPCRSPPRLDPYYCASPFRGNASVGSLLCSISQEHCVESDSNEFMLPPLLSPVHSPQRQLCQRSFSCCSSSTTDEANMEEEEEEEMNKDASNLPQNDNCKDCLEHHIEELERDLSDFTTPETPRESQSSPSSEEESDDEDDVEQGNRISEQVSLHRKIKPSLSSGVLTEPCSSSCSDEENGAALSDGESHSDTEEGSSPFKIGNREDDKTQGEAAGDSQPGILDELTAYEQDILLVDVIQDDPELFYNLPDQSLLKLGPTRAAEAPGTKPAAVVNTPRRDGASQELQERLAPVTVGLPCDSPDNTEESNSRPWRPHSTSTHTGTQSDTCPTSTEKQSKHVVQSDTNNNHVNSGPERSQPIKTVNSFQNIPPLMSMGTGAWITNSANMMDFRRLKSSSYCRLYFSESLTCGFKMCRFQHLPMEGDEKFCIESVTRFIKNPMCLQKAGAVFTGYYQKNPPGVYFSLPIFFSLLWALLKAGMLSEVFSVLSVGLAHNIVPSHEFLLSLFNCVREKGLMGFVPELMQLTFKMANAGLELSLDCLDCVRNTPLFQQMIHPNSPLVSGNNKVSPGAPFPEYLNLAHSIVEMELCMKQEDWRRIGEVFRGICQSNQHPSQVERISGRIAVALLSEGKDKLSLPFSVFAETVCQNESEDSMVRSFVGRIGVSLMLRYHKTHQWAKGRRVVETLSVLKVGFSTLKGLFGNEDGASRCCLITVAAELFLLSGSVEGALNTLRENKWFLSSSSWPCEPADLESRTRVLIRLAEKTSHRDTLELLCNLPGVKESSDSMDISRYSPLFNSHLQVCVDRQILPVASDTVDFMLSKNLAVEHTVLRILLQKLGKQNLWLRAREVFRHSLSVGYYPGVSAPPGFMTLIVPCRLGEVELALTFEMFITVNATVIHHLSEPTTSLTITLKR"
     misc_feature    <3818..4360
                     /gene="topaz1"
                     /note="Putative aspartate racemase; Region:
                     Asp_Glu_race_2; pfam14669"
                     /db_xref="CDD:291341"
ORIGIN      
cgagggccccgaatagtaacgtaatgatggtttaaaaagaacaagttccagcgttactctgaaaaatacttttatagcagcctggtaaattatttaataggatttggaaggcacagttttaactgttagcatgtttccatcttctagcagggtgaaactcaacagagttgcgctaaaagacgttgttgggttaaagctgaccccgcggcggagacgagtcccaaagttaccgaatagaatttcggctgaaagcaaaaaacaagagaaaaactctgattccgtgcagctaatgtcacagaaagatatggtgtcacctccgggcagcaatgaacccgaccaaaacttaacgcacacaatgggtttcgaaaagaagacacaggcgcccagcactcacgacgaggaggagccggaggagaatggctcagatgttgatagacataaagagccaaacctctccggtcttgctggttcagaagtgttactaagaagagccgtcggagcctcccactgtggtctctgtggggaatgtaaatacacttcccctcagctcaaggcgccgggtaagctaaaaagagctagcccagcgtcagagccacctgctgctcagtcagaaatcgaaaaagaaaacacaatcactcagagctctaagaagattatcgtgtggataaaccagtatcccaaagtgatcctttgtgacgttgccaaaaaatgtgaagcttgcggtcacgattgtgggtatgtgttaccggatgctctcgagaacaaggttgtgcgttgcttccagcaggagatgagagcttcattacggttttggcctacttgtttaaggcataatgaatcagaaactgagaaaaaggctctgtttaaaagtagcaagtgttgtccaagtgctcaggatgagaagaccgtctgtcagtctcaaagtctgatccgccagaaccacctggatgagggcatgcattcacagccattatcccatcatgccgtgagtcctttccaccggagtcagacaggcgaagactctgcaacttgttctgcttcttttttactagatgagcatacaaagacaggcaactgcagaggtggcatgcgtgacagagatgctgaagtggaccatggtccaggatctgatccagtaagcccagagacttgtagagaaaaaggaaaggtaggggatagcattgagtgcagcagcactttggactttgcgcccacagataagtgttgcgcttcaggtggtcagaaaggcgatcccacaaatgctgatggatcacacgtgttgtcagatctcatcgatcatgttagtgacgaggatacagatgcaccagagtcgtacacttgccagcgagtaaaggcgtatttgagaaaaatacatttttcatgtgcacgcacttacatggcctggcctttctcaaagacttgcacagcaaatgcttctgccacagcagggactattgatccatcagcaaaggatgggattgactctgcaacagctaatcaaagtatgccaggttcatccggtaacctgttcaaggacattcccccgaaggcgcctacagagaaatgggaagaggatggggaaagcgcttttgctcagggaaatgcgaaaaggcatagaaaagacatggagacctcaccgctgtttaaccagcctgaagagtcagaaaccaggcctaattcagatacggcatcattcccccctccagctcagtgcggaagggagcgtggcactgatggagtctcagcctcggctttgctagttaatggaccagaaactgtcacctccatatcgaccccttccccctcagtcctcagcctgagtgactgggacactgccaccactctgtctcttatgtcatctccattcacacagggcagcatgagcagcctctcagccacaacatcttctctcccaccttcatcgtttattcccaagagagtcaatgttgctgacaaaatattgtcctcctgtgaagaagcccaaacagcttcttcctctcccaatgttcctctgcacacccctgactcctttcattcatgtgaatcctctgtccttcctcaagatgaacatgaaaatgacaaggaacggttcccatgcaggagcccccccagactggacccatattattgtgcaagtccgtttaggggcaatgcttcagtgggttcactattgtgcagcatctcccaggaacactgtgtagagtcagactcgaatgaattcatgcttccacctttgctctcccctgtccattcaccacaacggcagttgtgccagagaagcttctcgtgctgcagctcaagcactacagatgaggcaaacatggaagaagaagaagaggaagaaatgaacaaagatgcgagcaacttgccacaaaatgataattgcaaggattgtcttgagcaccatattgaagagttggaaagagacttgtcagactttacaactcctgagacaccaagggaatctcagtcttctcccagcagtgaagaagaaagtgatgacgaggatgatgtggagcagggtaaccgaatttcagaacaagtttccttacatcgtaaaataaagccgagccttagctcaggtgttctgacagagccctgctcttcttcctgcagcgacgaagagaacggtgcggctttgagtgatggagaatcacactcggacacagaagagggatcaagcccgtttaaaataggaaacagggaagacgataaaacccaaggagaagcagctggtgattctcagcctggcattttggacgagttaacagcctacgaacaggacatcctgcttgttgacgtgatccaggacgacccagaactgttttacaacctgcctgatcaaagtttgctgaagctgggtcctacccgagctgccgaggctccgggaaccaaacctgctgctgtggtgaatactccaagaagagatggagcgtcacaggagctgcaagagagattggctccggttactgtgggtttgccttgtgacagtcccgataacacagaggagagtaacagcaggccatggagacctcattctaccagcacccatactggaacacagagcgacacatgccctacctccactgagaagcaaagcaaacatgtggttcaatctgataccaacaacaatcatgtaaatagtggcccagaaaggagccagcccatcaagacggtgaactcctttcaaaacatccccccactcatgtccatgggaaccggggcgtggatcacaaactcagcaaacatgatggattttaggcgcctgaaatcaagttcttactgcaggctgtacttcagtgaatcactgacctgtgggttcaaaatgtgtcgcttccaacatctgcctatggagggggatgaaaagttttgtattgaaagcgtgacaagattcatcaaaaatccaatgtgccttcagaaagcaggagctgtgtttacaggatattaccagaaaaacccaccaggagtgtatttctctttgccgatatttttctccctcctctgggctctgctgaaagctggcatgttgtccgaggtcttctccgtcctcagtgttggcttggctcacaacatagtgcccagccatgagttcctcctctccctttttaactgcgtgagagaaaagggtctgatgggctttgtgcctgaactcatgcagctcactttcaagatggccaacgctggactagagctgagtttggactgcctcgactgtgtaaggaacactcctcttttccagcaaatgattcatccaaactcgcctttggtgtccggcaacaacaaggtttcccctggtgcaccgtttccagagtacctgaatttagcccattccattgtggaaatggagctttgtatgaaacaagaggactggaggaggataggtgaggtttttagagggatctgccagtccaaccagcaccccagccaagtggagcgcatcagtggtcgcattgctgtcgcgctcctgtctgagggcaaagacaagctgtcactgcccttttctgtatttgctgagacagtgtgtcagaatgaaagtgaggacagcatggtgaggagtttcgtaggcagaattggagtctctctgatgttacggtaccacaaaacgcatcagtgggccaaggggcgcagggtggtcgagacgctgtctgttttaaaagtcggcttctcaactctgaaaggtctgtttgggaacgaggacggagcgtcacgatgctgcctgatcactgtggctgcagagctcttcctcctgagtggcagcgtggagggagctctgaacacactccgagaaaacaagtggttcctgagttcgtcctcatggccgtgtgagcctgccgatctggagagcaggactcgtgtgctgatacgtctggctgaaaaaacctctcacagagacacgctggagcttctctgtaatcttcctggagttaaagagtcaagtgactctatggatatctccaggtacagccccttgtttaactctcaccttcaagtgtgtgtggacaggcagatacttcctgtggcttcagacacggtggactttatgctctctaaaaacctggctgttgagcacacagtgcttcggatacttttacagaaactgggcaagcaaaacctctggctccgggctcgggaagtcttcagacattctctgagtgtgggctactaccctggagtctcagctccccctggtttcatgacactgattgtcccctgtcgactgggggaggtggagctggctctcaccttcgagatgttcatcactgtcaacgcaacagtcattcaccacctatcagagcccactacttctctcaccattactctcaaaaggtaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]