GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 23:21:12, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_006732551            4422 bp    mRNA    linear   MAM 30-SEP-2019
DEFINITION  PREDICTED: Leptonychotes weddellii argonaute RISC component 4
            (AGO4), transcript variant X2, mRNA.
ACCESSION   XM_006732551
VERSION     XM_006732551.1
DBLINK      BioProject: PRJNA232772
KEYWORDS    RefSeq.
SOURCE      Leptonychotes weddellii (Weddell seal)
  ORGANISM  Leptonychotes weddellii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia;
            Phocidae; Leptonychotes.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_006383411.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Leptonychotes weddellii Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4422
                     /organism="Leptonychotes weddellii"
                     /mol_type="mRNA"
                     /isolate="WS11-02"
                     /db_xref="taxon:9713"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="liver"
     gene            1..4422
                     /gene="AGO4"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 14 mRNAs, 2 ESTs, 14 Proteins, and
                     99% coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:102748534"
     CDS             2..2587
                     /gene="AGO4"
                     /codon_start=1
                     /product="protein argonaute-4 isoform X2"
                     /protein_id="XP_006732614.1"
                     /db_xref="GeneID:102748534"
                     /translation="
MEALGPGPPTSLFQPPRRPGLGTVGKPIRLLANHFQVQIPKIDVYHYDVDIKPEKRPRRVNREVVDTMVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDMEVTLPGEGKDQTFKVSVQWVSVVSLQLLLEALAGHLNEVPDDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPIIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYSLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHSEMTELTGRVLPAPMLQYGGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKMTYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQEISQELLYSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCADKTERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYQVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKDHDSAEGSHVSGQSNGRDPQALAKAVQIHHDTQHTMYFA"
     misc_feature    77..466
                     /gene="AGO4"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:318646"
     misc_feature    497..649
                     /gene="AGO4"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:312283"
     misc_feature    650..1012
                     /gene="AGO4"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(806..808,851..853,893..895,905..907,959..961,
                     980..982,986..988)
                     /gene="AGO4"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1151..2458
                     /gene="AGO4"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1562..1564,1574..1576,1610..1621,1628..1630,
                     1652..1654,1661..1663,1673..1675,1685..1687)
                     /gene="AGO4"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(1766..1768,1772..1774,2012..2014,2426..2428)
                     /gene="AGO4"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
catggaggcgctgggacccggacctccaaccagcctgtttcagccacctcgtcgtcctggccttggaactgttggaaaaccaattcgactgttagccaatcattttcaggttcagattcctaaaatagatgtgtatcactatgatgtggatattaaaccagaaaagcggcctcggagagtcaacagagaggtagtagatacaatggtgcggcacttcaagatgcaaatatttggtgaccggcagcctggctatgatggcaaaagaaacatgtacacagcacatccactgccaattggacgggatagggttgatatggaagtgacccttccaggtgagggtaaagaccaaaccttcaaagtgtctgttcagtgggtatcagttgtgagccttcagttgcttttagaagctttggctgggcacttgaatgaagtcccagatgactcagtacaagcacttgatgtaatcacaagacaccttccctccatgaggtacactccggtgggtcgttcttttttctcacctcctgaaggttactaccaccctctgggagggggcagagaggtttggtttggctttcatcagtctgtgagacctgctatgtggaatatgatgctcaatattgacgtgtctgcaactgctttctaccgggctcagcctatcattgagttcatgtgtgaggttttagacattcagaacatcaatgaacagaccaaaccgctaacagattcccagcgtgtcaagtttaccaaagaaatcagaggtcttaaagttgaggtgacccactgtggacagatgaaacgaaaatatcgagtttgtaatgtgactagacggccagccagtcatcaaacttttcctttacagctagaaaatggtcaagctatggaatgtacagtagctcagtattttaagcagaagtatagtctgcagctgaaatacccccatcttccctgtctccaagtgggacaagaacaaaaacatacgtatttgccacttgaggtctgcaatatcgtggcaggacagcgatgtataaagaagctcacagacaatcagacttccacaatgatcaaagctacagcaagatcggctcccgacagacaggaagaaatcagtagactggtgaagagtaacagcatggtgggtggaccggatccctaccttaaagaatttggtattgttgtccacagtgaaatgacagagctcacaggcagggtacttccggcaccgatgctgcaatatggaggccggaataaaacggtagccacacccaaccagggtgtctgggacatgcgaggaaagcagttttatgctggcattgaaattaaagtttgggcagttgcttgttttgcgcctcagaaacaatgtagggaagatttactaaagagtttcactgatcagctccgtaaaatctctaaggatgcaggaatgcctatccagggtcaaccctgtttctgcaagtatgcacaaggtgcagacagcgtggagcccatgttcaaacacctgaaaatgacctacgtgggcctacagctgatcgtggttatcttgcctgggaagacaccagtgtatgcggaggtgaaacgtgttggagataccctcctgggtatggccacacagtgtgtccaggtaaaaaatgtagtgaagacctcaccccaaaccctttccaacctttgcctgaagataaatgcaaagctcggaggaattaacaacgtgcttgtacctcatcaaaggccctcggtgttccagcagcctgtcatcttcctgggagcggatgtcacgcaccccccagcaggggacgggaagaagccttccattgctgctgtcgttggcagtatggatggccaccccagtcggtactgtgccactgttcgggtgcagacctcccgccaggagatctcccaggagctcctgtacagtcaggaggtaattcaggacctcactaacatggttcgagagctgctgatccagttctacaaatctacacgcttcaaacccactcggatcatctactaccgtggaggggtatcggagggacaaatgaaacaggtcgcctggccagagctaatagcaattcgaaaggcatgtattagcttggaagaagattaccggccaggaataacctacattgtggtgcagaagagacaccacacacgacttttctgtgcagataaaacagaaagggtggggaaaagtggcaatgtcccagcgggaactacagtggatagtaccatcacgcatccatccgagtttgacttttacctctgtagtcatgcaggaattcagggaaccagccgtccttcacattaccaggtcttgtgggatgacaactgcttcaccgcagatgagctccagctcctaacttaccagctatgtcacacctacgtgcgctgcacgcgctcagtctccattccagcccctgcgtattatgcccggcttgtagctttcagggcaaggtatcatctggtggataaagatcatgacagcgcggaaggcagtcatgtgtcaggacagagcaatggccgggatcctcaggccttggccaaggctgtgcagatccaccatgatacccagcacacgatgtattttgcctgagagtctcagaaaaagaactcaaccaatttggcaccccatgcagcctcaaaacgtttcaaatgcctaccgcctctagagagagccaagttgacttcaggtggtcttctaccagcagctcggaatagttgcactgaatctatactttgcagcactgtctgatgcatcaacaaaattgagccattttttaaaagtaatagatactcatagattgtcttttctgatgcactggactgaatttttacctcatcatgcaaaggctgatcagcctgaacttccttaaggactttacaagaaaggtttctatggaatattttgctagctgtggtgttcaccgcatccctctagtcttataagagaagattattccttgttttctgtactcattgagtggggtgtatgcaaaagtgggagagaaaaaccaaacaatctacttcagttcagcgtaactttttaattatgtgggtccatagactttttaatggagatttctgacttcgccactgtaaatgcctttaacgagcattaatttttgaaagttttacagagctttattagttttcctactttatctccttgatctctacagacttgagctggtgcaagtacaggctgccaggcaattgcactgtatttggttgcaaattcagaccggcagttctctcatttggtcgactttcgtgaatgtgtagcagaaacagatataatgcatgtcacggtgacagataacactgccatggtaaaagtactcatgtttccccctctttgaaaaaaaaaactagcttttagtatttttcaaagttttcaaaagtgcccattttatgctgctctgtggtttgttagatctaaatgatttttaaactcttctcatagaaaattaactttggcaataagcatttttttaaggtcccctctcttcctcccccaacaatgtagttttctaggtgagatttcagtatgattttatcagctatttcttatagatcataatctggcaatttctgaaactggtcagaaaagacatatatttccatgactttaaagaattatttttatctgttttgtagtcacagctggtgtcctgtcactatgttttaaaataagctaggaccacgatgcttccttatcggatgggctttgccaatccttaaggtacattgagcgatgctgtgacctgcacaaatgtaccagcatttaaaactttttttcccaggaatcaaggttactcacacagtcatgtgcagtgcaaatttttttgcttctctttcaacctgaaatgtacttggtggggtttccttcctttcactaaactaaaactgcatagaaaaggttaatctttcttaatagattctagatcccactcgcaaggagacgggttcctttcttgtccaaacaaagggagctgatctaaagcaagcatcagtgaaaatgtagggaaaaaatgtattttgtatttagtgtagataacactttgtgaatggacaacagttacatagagtcttggtagttccagccagtgtttcccagcccagattttactgacttgtgattctctatcctggaacctcagaagtgagagctggagaaggggataaaagccccagagccacagtccgtatggctgaggaaagtgctggtggaagagacagacacaatgtgggaaaacgattttgccccttctgtctggaaactgctggtggggaaacactggatctgatggtgaagggtgtttgcttgaactcattagccggtccaaatctcttaaactagccttctcaaaatcccagcaatacaaagcactgtttttcttcagcctttcaaagaagcttgtaaataca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]