GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-28 20:18:26, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_006624947            2795 bp    mRNA    linear   INV 05-NOV-2019
DEFINITION  PREDICTED: Apis dorsata protein argonaute-2 (LOC102671554),
            transcript variant X2, mRNA.
ACCESSION   XM_006624947
VERSION     XM_006624947.2
DBLINK      BioProject: PRJNA232132
KEYWORDS    RefSeq.
SOURCE      Apis dorsata (giant honeybee)
  ORGANISM  Apis dorsata
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita;
            Aculeata; Apoidea; Anthophila; Apidae; Apis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_006264283.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Nov 5, 2019 this sequence version replaced XM_006624947.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Apis dorsata Annotation Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2795
                     /organism="Apis dorsata"
                     /mol_type="mRNA"
                     /db_xref="taxon:7462"
                     /chromosome="Unknown"
                     /tissue_type="whole body"
                     /country="Malaysia: Borneo, Tenom"
                     /collection_date="Feb-2007"
     gene            1..2795
                     /gene="LOC102671554"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 ESTs, 133 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 17 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:102671554"
     CDS             171..2660
                     /gene="LOC102671554"
                     /codon_start=1
                     /product="protein argonaute-2 isoform X2"
                     /protein_id="XP_006625010.1"
                     /db_xref="GeneID:102671554"
                     /translation="
MHDMYLAQIPKRTNQINKLGRNIIVETNMLKLIFAQNFQTNIIHYDVIITPDKPKFLLRTIFEEFRKKQCPKRYPAFDGKKNAYSAKILPFGDKSKEEEIKIVDVNTGKERNFKIYLNKVASLDLSWLTSLKCDLMDSEKNQKCIQALDIILRHGPAYHYTMVGRSLFQPPEPGRIVSLSNGLDLWVGVFQSVVIGSKPYLNIDVAHKGFPKSQSVIDLMKELCNVQDLTPKDIERNLVNINKFLKGLKIQYELPGQPTTKRTYRVNKLVDCPRENKFHLEDQTLYSVEKYFLQIKKYSIKYPNLPCLWVGSRNNSIYLPVELCTIIAGQVIHKEMNKIQTSKMIRETATNTQKRKEKIMNSFAKMNLNQQPTLMNEFHFSVNAEFEKVPARVLKPPKLQYKEKEVTVCKGTWKAEKFFSPCVLPKNLWTILNLDKFVHTHDLYNLHEKLLHGGKFLNMEIEEAQTPFTNLTIKTNISNIIEYFKDKKKQNILLVIVILPNLENAYSIVKQISELQIHEGIVTQCIKNQTLKKLNDSTIGNILLKINSKLNGINHIITPTNRPNCLHKPCMIIGADVTHPSPDAINIPSIAAVAASHDPNAFKYNVEIRLQSPREEIIQDLEEIMIIQLKYFYTTTRQKPQKLIFYRDGVSEGQLTQIMHKELFAIKKAIARLEKSDELKIPITFLVVQKRHHVRLFPTDVKNSDDKNFNVQAGTIVDTEITHPTHIDFYLVSHTSIQGTARPTKYRCICNENQMPENEIEQLTYYLCHMFARCTRSVSYPAPTYYAHLAAFRARALIHNIPLNIDNLQEEQRKKMTLRINKSSPMFFV"
     misc_feature    402..626
                     /gene="LOC102671554"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    657..806
                     /gene="LOC102671554"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    807..1151
                     /gene="LOC102671554"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(960..962,1002..1004,1032..1034,1044..1046,
                     1098..1100,1119..1121,1125..1127)
                     /gene="LOC102671554"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1293..2564
                     /gene="LOC102671554"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1686..1688,1698..1700,1740..1751,1758..1760,
                     1782..1784,1791..1793,1803..1805,1815..1817)
                     /gene="LOC102671554"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1896..1898,1902..1904,2112..2114,2532..2534)
                     /gene="LOC102671554"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
gacctaatcaacaacaacatagttcaccatcacaatcacataatcaaaggcaacagtcgaatagtcctcagcaacaagcatggagacctaatcaacaacaacaacannntaattcaccacaacaagaaactgctgttgttttaaaaaaaattgattcatttacacaaaatatgcatgatatgtatttggctcaaataccaaaacgaactaaccaaataaataaattaggtagaaatattattgtggaaacaaatatgcttaaactcatttttgcacaaaattttcaaacaaatattatacattatgatgtaatcataacaccagataaaccaaaatttttattaaggactatttttgaagaatttagaaaaaagcaatgtccaaaaagatatcctgcatttgatggcaaaaaaaatgcatatagtgcaaaaattcttccttttggtgataaaagtaaggaagaagaaataaaaattgtcgatgttaatacaggaaaagaaagaaatttcaaaatatatttaaataaagttgcatctcttgatttgtcatggttaacaagtctaaaatgtgatttgatggattctgaaaagaatcaaaaatgtatacaagcattagatattattttacgtcatggacctgcataccattatacaatggttggcagatcactttttcaaccaccagaaccaggaaggattgtatcattatcaaatggattagatttatgggttggtgtatttcaatctgttgtaattggatctaaaccatatttaaatatagatgttgcacataaaggatttcctaaaagtcaatcagttattgatttgatgaaagaactatgtaatgtacaggatttaactccaaaagatatagaacgcaatcttgttaatataaataaatttttaaagggattaaaaattcaatatgaattacctggacaacctactactaaaagaacttatcgtgtaaataaattagttgattgtccaagagaaaataaatttcatttggaagatcaaactttatattcggttgaaaaatattttttgcaaattaaaaaatattcaataaaatatcccaatctgccatgcctttgggtaggatctcggaataactcaatttatttacctgttgagttatgcacgataattgccggacaagttatacacaaagaaatgaataaaattcaaacttctaagatgattcgtgaaacagcaactaatacacaaaaacgtaaagaaaaaattatgaatagttttgctaagatgaatttaaatcagcagccaactttaatgaatgaatttcatttttctgtaaatgcagaatttgaaaaagtaccagcaagagttctaaagcctccaaaattacagtataaagaaaaagaagttactgtatgtaagggaacatggaaagcagaaaaattttttagtccttgtgttttaccaaagaatttatggactattttaaacttggataaattcgtgcatactcatgatttatataatttacatgaaaaactacttcatggtggtaagtttttgaacatggagattgaagaagcacaaactccatttacaaatttaactattaaaacaaatattagtaatattatcgaatattttaaagataaaaagaaacaaaatatactacttgtaatagtgatacttccaaatttagagaatgcatatagtattgtaaagcaaatttctgaacttcaaatacacgaaggtattgtaactcaatgtataaaaaatcaaactttaaaaaaattaaatgattcaacaattgggaatattctgttaaaaattaattcaaagcttaatggtattaatcatattattactcctactaatcgtccaaattgtctacataagccatgtatgataattggtgcagacgtgactcatccatcacctgatgctataaatataccctcaattgcagctgtagcagcaagtcacgatccaaatgcttttaagtataatgttgaaataagacttcaatcaccgagagaagaaataattcaagatttggaagaaattatgatcattcaattgaaatacttttatacaacaacgagacaaaaacctcagaaattaattttttatcgagatggagtaagcgaaggacaacttacacaaataatgcataaagaattatttgcaataaaaaaagctattgcacgtttagagaaatctgatgaattaaaaatcccaatcacatttcttgtagttcaaaaacgacatcatgtacgtctttttccaactgatgtgaagaattctgatgataaaaattttaatgtacaagcagggactattgttgatactgaaattacacatccaactcatatagatttttatcttgtatctcatactagcatacaaggtactgctaggcctacaaaatatagatgtatatgcaatgaaaatcaaatgcctgaaaatgaaattgaacaacttacatattatctttgtcatatgtttgcacgttgtacaagatctgttagttatcctgcgcctacatattatgctcatttagctgcttttagagcaagagcattaatacacaatattccattgaatatagataatctgcaagaggaacagcggaaaaaaatgaccttaagaataaataaaagttcacctatgttttttgtataaaataaatgtattattttaatatataacatgtaatatgtaatatgtaatatttttgaattttttgattgctattgatttataatagtattatataacatttttttttcaaatataataaaaaatgtttataatgaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]