GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-06-18 02:53:41, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_006485118            1352 bp    mRNA    linear   PLN 08-DEC-2022
DEFINITION  PREDICTED: Citrus sinensis protein STRICTOSIDINE SYNTHASE-LIKE
            4-like (LOC102608831), mRNA.
ACCESSION   XM_006485118
VERSION     XM_006485118.4
DBLINK      BioProject: PRJNA906997
KEYWORDS    RefSeq.
SOURCE      Citrus sinensis (sweet orange)
  ORGANISM  Citrus sinensis
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Sapindales; Rutaceae; Aurantioideae;
            Citrus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_068559) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Dec 8, 2022 this sequence version replaced XM_006485118.3.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: Citrus sinensis Annotation Release
                                           103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1352
                     /organism="Citrus sinensis"
                     /mol_type="mRNA"
                     /cultivar="Valencia sweet orange"
                     /db_xref="taxon:2711"
                     /chromosome="4"
                     /tissue_type="Young leaves"
                     /dev_stage="Mature"
                     /country="USA: Florida"
     gene            1..1352
                     /gene="LOC102608831"
                     /note="protein STRICTOSIDINE SYNTHASE-LIKE 4-like; Derived
                     by automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 5 ESTs, 1 Protein"
                     /db_xref="GeneID:102608831"
     CDS             44..1120
                     /gene="LOC102608831"
                     /codon_start=1
                     /product="protein STRICTOSIDINE SYNTHASE-LIKE 4-like"
                     /protein_id="XP_006485181.1"
                     /db_xref="GeneID:102608831"
                     /translation="
MAPKSFLLACLLAFTLQFFFSPPVSSSASLLSTSKESSSMKDLIKLGEGCVSHPEDVSVVVRKGALYTATNDGWVKYFILHNETLVNWKHIDSQSLLGLTATKEGDVIICDSKKGLFKVTEEGVKVLDPDVRFANDVIDASDGTLYFTVSSTKYTPADFYKDMAEGNPYGQLLKYDPKSNQTTVLQEGFYFANGIALSKDEDFVVVCESWKFRCRRYWLKGDRNGTLDTFAENLPGGPDNINLAPDGSFWIALIKMNQTGVKAIQNCREKWELLEAYPGLISLLLPMGSDAGARVVKVEGIDGKIIRDFNDPNATYLSFVTSAVEYNDNLFLASLQSNFIGVLPLHPLDTPKPVLATI"
     misc_feature    176..>802
                     /gene="LOC102608831"
                     /note="Sugar lactone lactonase YvrE [Carbohydrate
                     transport and metabolism]; Region: YvrE; COG3386"
                     /db_xref="CDD:442613"
     misc_feature    455..706
                     /gene="LOC102608831"
                     /note="Strictosidine synthase; Region: Str_synth; cl22863"
                     /db_xref="CDD:354965"
     polyA_site      1352
                     /gene="LOC102608831"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
ctagataactagcatacctaatagaagtagtgatttcaagctcatggctccgaagagtttcctgctagcttgtttacttgcttttactctacaattcttcttctcgcctccagtatcatcttcagcttctcttctttccacctccaaggaaagctcctctatgaaggatttgattaaacttggagaaggatgtgtgagccacccagaggatgtttctgttgtggttagaaagggtgcgctgtatacagctactaatgatggttgggtcaagtatttcatcctccataatgaaaccttggttaattggaagcacatagacagtcaatctcttcttggactcacagcaacaaaggaaggtgacgtcattatatgcgacagtaaaaaaggtttgtttaaggttaccgaagaaggcgtaaaggttcttgatccagatgtaagatttgcaaatgatgtgatcgatgcatcagatggcacgttgtattttactgtctcaagcaccaaatatacccccgcagatttctacaaagacatggctgagggaaatccttacggccagttgctcaaatatgatcctaaatcgaaccaaacaacagttttgcaagagggattttactttgctaatggcattgcactctcaaaagatgaagactttgtggtcgtttgtgaatcatggaaattccgatgcagaagatattggctgaagggcgatcgcaatggaacattagatacttttgctgaaaaccttccaggtggacctgataacatcaatcttgcccccgatggctctttttggattgctttaatcaagatgaatcagactggggtgaaggctatccaaaactgcagggagaaatgggaactattggaagcatatccaggattaatcagcctactcctccctatgggcagtgatgcgggtgcaagagtagtcaaagtcgaaggaattgatggcaaaataatcagggattttaacgatccgaatgcaacctatttatcatttgtcacttcagctgtggagtataatgacaatctcttcttggctagccttcaatcaaatttcattggggtactgccactccatcccctcgatactccaaaaccagtactggctaccatatagaaacaggatgcatgcatgcattaccatgctgtccgtgcatgtttgatgcttctactaaattataataagtctgtttttgtcggtgttttggtttggtttgtgttttattttcggcaagtctttctttaaggggttatggctttatgttctcccctctagcttgcttcttgttatcttttccttttatttcaataaaggtctctctttgagattcggcacgtattattatcaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]