GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-23 22:58:09, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_006445687            1112 bp    mRNA    linear   PLN 26-FEB-2018
DEFINITION  PREDICTED: Citrus clementina protein STRICTOSIDINE SYNTHASE-LIKE 4
            (LOC18050416), mRNA.
ACCESSION   XM_006445687
VERSION     XM_006445687.2
DBLINK      BioProject: PRJNA232045
KEYWORDS    RefSeq.
SOURCE      Citrus x clementina
  ORGANISM  Citrus x clementina
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Sapindales; Rutaceae; Aurantioideae;
            Citrus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_006262688.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Feb 26, 2018 this sequence version replaced XM_006445687.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Citrus clementina Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1112
                     /organism="Citrus x clementina"
                     /mol_type="mRNA"
                     /cultivar="Clemenules"
                     /db_xref="taxon:85681"
                     /chromosome="Unknown"
     gene            1..1112
                     /gene="LOC18050416"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 7 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:18050416"
     CDS             19..1095
                     /gene="LOC18050416"
                     /codon_start=1
                     /product="protein STRICTOSIDINE SYNTHASE-LIKE 4"
                     /protein_id="XP_006445750.1"
                     /db_xref="GeneID:18050416"
                     /translation="
MAPKSFLLACLLAFTLQFFFSPPVSSSASLLSTSKESSSMKDLIKLGEGCVSHPEDVSVVVRKGALYTATNDGWVKYFILHNETLVNWKHIDSQSLLGLTATKEGDVIICDSKKGLFKVTEEGVKVLDPDVRFANDVIDASDGTLYFTVSSTKYTPADFYKDMAEGNPYGQLLKYDPKSNQTTVLQEGFYFANGIALSKDEDFVVVCESWKFRCRRYWLKGDRNGTLDTFAENLPGGPDNINLAPDGSFWIALIKMNQTGVKAIQNCREKWELLEAYPGLISLLLPMGSDAGARVVKVEGIDGKIIRDFNDPNATYLSFVTSAVEYNDNLFLASLQSNFIGVLPLHPLDTPKPVLATI"
     misc_feature    151..>777
                     /gene="LOC18050416"
                     /note="Sugar lactone lactonase YvrE [Carbohydrate
                     transport and metabolism]; Region: YvrE; COG3386"
                     /db_xref="CDD:442613"
     misc_feature    430..681
                     /gene="LOC18050416"
                     /note="Strictosidine synthase; Region: Str_synth; cl22863"
                     /db_xref="CDD:354965"
ORIGIN      
agtagtgatttcaagctcatggctccgaagagtttcctgctagcttgtttacttgcttttactctacaattcttcttctcgcctccagtatcatcttcagcttctcttctttccacctccaaggaaagctcctctatgaaggatttgattaaacttggagaaggatgtgtgagccacccagaggatgtttctgttgtggttagaaagggtgcgctgtatacagctactaatgatggttgggtcaagtatttcatcctccataatgaaaccttggttaattggaagcacatagacagtcaatctcttcttggactcacagcaacaaaggaaggtgacgtcattatatgcgacagtaaaaaaggtttgtttaaggttaccgaagaaggcgtaaaggttcttgatccagatgtaagatttgcaaatgatgtgatcgatgcatcagatggcacgttgtattttactgtctcaagcaccaaatatacccccgcagatttctacaaagacatggctgagggaaatccttacggccagttgctcaaatatgatcctaaatcgaaccaaacaacagttttgcaagagggattttactttgctaatggcattgcactctcaaaagatgaagactttgtggtcgtttgtgaatcatggaaattccgatgcagaagatattggctgaagggcgatcgcaatggaacattagatacttttgctgaaaaccttccaggtggacctgataacatcaatcttgcccccgatggctctttttggattgctttaatcaagatgaatcagactggggtgaaggctatccaaaactgcagggagaaatgggaactattggaagcatatccaggattaatcagcctactcctccctatgggcagtgatgcgggtgcaagagtagtcaaagtcgaaggaattgatggcaaaataatcagggattttaacgatccgaatgcaacctatttatcatttgtcacttcagctgtggagtataatgacaatctcttcttggctagccttcaatcaaatttcattggggtactgccactccatcccctcgatactccaaaaccagtactggctaccatatagaaacaggatgcatgcat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]