GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:24:05, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_005142539            6155 bp    mRNA    linear   VRT 04-OCT-2019
DEFINITION  PREDICTED: Melopsittacus undulatus argonaute RISC component 4
            (LOC101868627), mRNA.
ACCESSION   XM_005142539
VERSION     XM_005142539.2
DBLINK      BioProject: PRJNA197262
KEYWORDS    RefSeq.
SOURCE      Melopsittacus undulatus (budgerigar)
  ORGANISM  Melopsittacus undulatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria;
            Aves; Neognathae; Psittaciformes; Psittacidae; Melopsittacus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_004848102.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Oct 4, 2019 this sequence version replaced XM_005142539.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Melopsittacus undulatus Annotation
                                           Release 103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6155
                     /organism="Melopsittacus undulatus"
                     /mol_type="mRNA"
                     /db_xref="taxon:13146"
                     /chromosome="Unknown"
                     /sex="male"
     gene            1..6155
                     /gene="LOC101868627"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 21 ESTs, 16 Proteins, and 99%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 7 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:101868627"
     CDS             190..2574
                     /gene="LOC101868627"
                     /codon_start=1
                     /product="protein argonaute-4"
                     /protein_id="XP_005142596.1"
                     /db_xref="GeneID:101868627"
                     /translation="
MVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDMEVTLPGEGKDQTFKVSVQWVSVVSLQLLLEALAGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPIIEFMCEVLDIQNINEQSKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYSLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNEMTELTGRVLPAPMLQYGGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKLTYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQETSQELLYSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCADKTERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYQVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKDHDSAEGSHVSGQSNGRDPQALAKAVQIHHDTQHTMYFA"
     misc_feature    <190..453
                     /gene="LOC101868627"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    487..636
                     /gene="LOC101868627"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    637..999
                     /gene="LOC101868627"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(793..795,838..840,880..882,892..894,946..948,
                     967..969,973..975)
                     /gene="LOC101868627"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1138..2445
                     /gene="LOC101868627"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1549..1551,1561..1563,1597..1608,1615..1617,
                     1639..1641,1648..1650,1660..1662,1672..1674)
                     /gene="LOC101868627"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(1753..1755,1759..1761,1999..2001,2413..2415)
                     /gene="LOC101868627"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
tccctagggcccccaacaagccttttccagccaccccgtcgcccaggcctgggaactgttgggaaacccatccgcctcctggccaaccatttccaggttcagatccccaagattgatgtctatcactatgatgtagatattaaaccagaaaagcgccctcgaagagtcaacagagaggtggtggatactatggtgagacacttcaagatgcagatattcggtgatcggcagcctggatatgatgggaaacggaacatgtacacagcacaccccttacctattggccgggatagagtggatatggaggtgacgcttccaggagaggggaaggaccagacatttaaagtatccgttcagtgggtgtcagtcgtcagccttcagttgctgctggaggctctggcagggcacttgaatgaagttccagaagattctgtacaagcacttgacgtgatcacacggcaccttccctccatgaggtacactcctgtgggtcgctcctttttctcccctcctgaaggttattaccaccctctgggtggtggcagggaggtctggtttggtttccaccagtcagtcaggcctgccatgtggaacatgatgctcaacattgatgtgtcagcaactgctttctatcgtgctcagcctatcattgagttcatgtgcgaggtcttggacattcagaacatcaatgagcaatccaagcctcttacagactcccagcgtgtcaagtttaccaaagaaatcagaggtctgaaagtagaggttacccactgtggccagatgaagagaaaataccgggtttgcaatgttactcggcgaccagctagtcatcagacgtttcctctgcagctggaaaatgggcaggctatggagtgcacagtagctcagtattttaagcagaagtacagtctgcagctgaaatatcctcaccttccctgtctccaagtagggcaggagcagaaacacacgtacttaccacttgaggtgtgtaacatagtggcaggccagagatgtataaagaagctaacggacaatcagacatcgactatgataaaagcaactgcaagatctgcacctgaccgccaggaagaaatcagcagactagtgaaaagtaacagtatggttggtggacccgatccctacctgaaggagtttggtattgttgtccacaatgaaatgacagagttgacaggcagagttttgccagcaccaatgctgcaatatggaggcaggaacaagactgtggccacaccaaaccaaggtgtgtgggacatgagaggcaaacagttctatgctggcattgagattaaagtttgggctgttgcctgttttgctcctcagaaacaatgcagggaagacttactaaagagtttcacagaccagctgcgcaagatctccaaggacgcagggatgcccatccaaggccagccctgcttctgcaaatatgcccagggtgccgacagtgtggagcccatgtttaaacacttaaaactcacttatgttggtctgcagctgatcgtggtgattctacctggaaagacacccgtgtatgctgaagtgaagcgggttggtgacactctcctaggaatggccacgcagtgtgttcaggtaaagaatgtggtaaaaacctcaccacaaacgctgtccaacctgtgtctgaagatcaatgcaaagcttggaggaatcaacaatgtgctggtacctcatcaaaggccctcggtgttccagcagccagtgatctttctgggagcagacgtcacccaccctcctgctggggatgggaagaagccttccatcgctgcggtggtgggcagcatggacgggcaccccagccgctactgtgccacagtgcgtgtgcagacctcgcgccaggagacctcccaggagctgctctacagtcaggaggtgatccaggacctcactaacatggtgcgagaactcttgatccagttctacaaatccactcgtttcaagcccacaaggatcatttactacagagggggagtatcagaaggacagatgaagcaggtagcttggccagagctgatagcaatccggaaggcctgtattagtttggaagaagattacagaccaggaataacctacattgttgtgcagaaaaggcatcacaccaggctattctgtgctgacaaaactgaaagggtgggtaagagcggcaacgttccagcaggcactactgtggacagcacgatcacacatccttctgaatttgacttttacctctgtagccatgcaggaattcagggaaccagccgcccctctcactaccaggtcctgtgggatgacaactgctttaccgcagacgaactgcagctgttgacataccagctgtgtcacacgtatgtccgctgtacgcgatccgtctctatcccagctcctgcctactatgccaggctggtagcgtttagagccagataccatcttgtggacaaggatcatgacagtgctgaaggcagccatgtgtcaggacagagcaatggccgtgatcctcaggctctggcaaaagcagtgcagatccaccatgacactcagcatacgatgtattttgcttgagagcatctgggaagatgaggcaaaaccaacaacccgtgcagtcctgaaatgttttgaatgcctactgctatagctggggcccagttgatttcaggctgcccattaccagcagctctgaccagtcgcactgaatctgtacttcacagcaatgtctgatgcaccaacataattgagccatttgtttcattgttttctgtaatagaaattcatagacttgtcttttctgatgcattggactgaatttttacctcaaaagtgtaaaaggccgatcatcctgacatttttaaaggatttggcacgaaaggtttctattgaatattttgctagctatcgtttttgagttctcttctcatcccatgagcttaacatgacgacttgattccccgtcttcacgccctgcttagtgagtatgcatattgatggcaaaatgtttttctccggttcaatgtaattgttctattgtgtggggccatagattttttaatggagattttagacttcactactgtaaatgccttttatggaacgtaactttcacaggtattgcagttttttgtcagttttactaagtatctttttaatctctgcagacttcggctgcgaagcaattgcactatactgcgagttcgactaggtggttcttgttctgtgaatgtgtaatataaacagatagtgatgcctgtcagtagatcttaattctaatggttataaataatactgccatggtatcgtaacaagtactgaaccatcatttcccccctctaaaaatgataaaaaaaaagaaaacacaaaaaaattagcttttaggtattttgcagacttttacaaaagtgcccacttgatgctgctgtgtggtttgataaatctaagggattttaaaacttttttctcctagagggtttaactttggcaataaatctttgttttttaagcccccccaacagtgtaattttctagctgaggattgtgcatgagtcgaaccgacattctcgtgtcgtttttctgaacacacaatttggcagtttcggtaacgaattgggaaagatgcatttccatgctttttttaagacttatttttaactgttttatattcactgttggtgtcctgtctacagcattttttataagcttggaaactgggtgttacgtgtaggaaaggcttgccaatctgtacagtctacatgtattgtgtgaccggcaacctacttgctaccagcattttcaactctttggttttctcttcccctggaaatctaggttgcgcacacaactgcatccaacagcatgtttaaccaacgtaactctcatctactgattctgtcccagcctagaagttagggttttggttaatctgcttggctttgtttcagctgcagtgtagaataaagaagaggggctcggtttcaccggatgctctcggaatccgtgaacatggtgtgttaagactagatcccccttagtgttaacctgagctagtgcagattaaaaccttcttcctaaactgaggagagccgacaccactacttcagtaacgggagctgaagtccaaggattgcactgtgggctctgatgctcgtgtggggtttgctgctaagttgtctgctgttccaaagcataggaaccagccccctcaaaatttcagcaatatgaaatgctgtttccttcaatctttaagcttgtaaataaatgaaagtttacatttctaaccgctgggggttactttcagttgtaccagagtacactgaacttagacttcagacagttttataaccacctttcaagtaggacgtctcatgaaattaagttgaaacttttattcctttctgttgcaaatgggactgaagcaaactctgctcctggcacatgccaagggcagggttagattgaaaggaaaaaagattctttttgaagttttcttaattcttttttgtttaaagaatacctcacttgtgtaataaaatcaggacgtgggtgggagactgaccgctgcttcagctggatggctgctttctcagtactcgttcagggagaacacaaaaaaccccccttgttagaatgaactctgactgacccaacacaaaccagagaactttggcaccttgaaaagaaactgagcgccctttttaggtggtaagatcaaggatcactattttgagtttgtgcactaggcaagaatgtggctggtttaatggagggtgcgtaaggaagatgtagtttgtagttgtccagtgccaagcactcctagttcggattgagtgaagcgagagcctctcctttgtttgcctgggaccggactcgatgtttaacctcaggctaggtgggttgttagacctcgccttgggaggagagtcaggactgtggcatggtggtaccggtaagaccaacactgcggcagttcctgcacaggtctgaggccacaaatggaggttgggcttgacatctggattagccccttgggcctgactgaatcgttatgcatgtgtcaatcaatgggaagatgtgcattctgtagatgtagttcttagggtgttttgggtttggtttttgttatttttttaactaaataaagcctgttggccactgtttagctctgtggtgtgaaagagtttaaatgtagcaatgtttaacgagttgggcagggggtggttggtgtttgaaaccacaaaaggggggcagaaatcctgttttcaagcagttctgcttgctttgtgaacagctgcattctgaacaagcgctggtgatggttttgaagggcctggtgctttatctgtgctctaagtaccacagttggctgcatccgaagggcatcggaggtggctgctcgcagcacagctctgctcccaggtcaaaccccaccagcagctctattctgtgcattggggaccttgttcagatccagtgtttaacacaacccacccccaagctccctttgtggatgtgctgtaggagttttcttgctcaatagcaagggagtcgctctgctttcattttcggaaggcagggtttggagggcattgtatcaatcctgttctgactacaaggcttcttccttgtgcactggaggaaagaccttgaaatatcacagattttcttataccttgctattgacattttcatatttctatgtctagagctgaaacttcaatgtaagatgtttgcatttgttcctttggacttacgatgtaattctttttgtttctatattgttggacttgtaatgttgaaacctgtattttactaaatggggactggatgtatgtctatagcaatacgaggtactctttctgaactgtcctgggcaggtgacagccccacgttgcgctaagatgctggtcgtgtacaacttgcaatgtatttttttttagcctgcagggatattttgtgttcatgtgtccaaaaaaaaggaataagaataaggataataataaaaaaaggcattcttgtgccaaatgttgtttttccttgttgctgtctaataaatgcaatgtacagagtgagcaactgctactgctgcctgtaaacaaatgtcttaaattatttaacttttaattaaaccttgtacactatgtgtaagctgtgga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]