GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 11:59:07, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_004697379            2735 bp    mRNA    linear   MAM 19-SEP-2019
DEFINITION  PREDICTED: Echinops telfairi argonaute RISC catalytic component 2
            (AGO2), mRNA.
ACCESSION   XM_004697379
VERSION     XM_004697379.2
DBLINK      BioProject: PRJNA193504
KEYWORDS    RefSeq.
SOURCE      Echinops telfairi (small Madagascar hedgehog)
  ORGANISM  Echinops telfairi
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Afrotheria; Tenrecidae; Tenrecinae; Echinops.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022103896.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 25, 2015 this sequence version replaced XM_004697379.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Echinops telfairi Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2735
                     /organism="Echinops telfairi"
                     /mol_type="mRNA"
                     /isolate="266"
                     /db_xref="taxon:9371"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="Germany: Ludwig Maximilians University, Munich"
     gene            1..2735
                     /gene="AGO2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 mRNAs, 41 Proteins"
                     /db_xref="GeneID:101648413"
     CDS             91..2541
                     /gene="AGO2"
                     /codon_start=1
                     /product="protein argonaute-2"
                     /protein_id="XP_004697436.1"
                     /db_xref="GeneID:101648413"
                     /translation="
MDIPKIDIYHYELDIKPEKCPRRVNRYSLRPRAQPGKPDTCGDKRLCPPATEPWQPTGTCLTMCDLHPQVELEVTLPGEGKDRIFKVSIKWVSCVSLQALHDALSGRLSSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKTLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQVLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHTSGQSNGRDHQALAKAVQVHQDTLRTMYFA"
     misc_feature    91..459
                     /gene="AGO2"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    490..639
                     /gene="AGO2"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    640..1002
                     /gene="AGO2"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(796..798,841..843,883..885,895..897,949..951,
                     970..972,976..978)
                     /gene="AGO2"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1135..2412
                     /gene="AGO2"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1546..1548,1558..1560,1594..1605,1612..1614,
                     1636..1638,1645..1647,1657..1659,1669..1671)
                     /gene="AGO2"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(1750..1752,1756..1758,1966..1968,2380..2382)
                     /gene="AGO2"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
cccctccaaggatatgccttcaagccccctccgagacccgacttcgggacctctggaagaacaatcaaattacaagccaatttcttcgaaatggacattcccaaaatcgacatctaccactatgaattggacatcaagcctgagaaatgcccacgcagagtcaacaggtattctctcagaccccgcgcacagcctgggaagccagatacctgtggagacaagcgcctgtgccctcctgccacagaaccgtggcagcccactgggacgtgcctgaccatgtgtgatctgcacccacaggtggagctggaggtcaccctgcctggggaaggcaaggaccgcatcttcaaggtgtccatcaagtgggtgtcctgcgtgagcctgcaggcgttacacgatgcactttcagggcggctatccagcgtgcccttcgaaacgatccaggccctggacgtggtcatgcggcacctgccgtccatgaggtacacccctgtgggccgctccttctttaccgcctccgagggctgttccaaccccctgggtgggggccgagaggtctggtttggcttccaccagtccgtccgaccctcgctttggaaaatgatgctgaatattgacgtctctgcaacggccttttataaggcacagcctgtgatcgagttcgtttgtgaagttctggattttaaaagtattgaagaacaacaaaaaactctgacagattcccaaagggtcaagtttaccaaagaaatcaaaggtctaaaggtggagataacgcactgtggccagatgaaaaggaagtaccgagtctgcaacgtgacccggcggcctgccagccaccaaacgttcccgctgcagcaggagagcggccagaccgtggagtgcacggtggcccagtacttcaaggacaggcacaagctggtgctgcgctacccccacctcccatgtttacaagttgggcaggagcagaaacacacctaccttcctctggaggtctgcaacatagtggctggacagaggtgcatcaagaaacttactgacaatcaaacctcaaccatgatcagagcgacggccaggtctgcgcccgaccgccaggaagagatcagcaaactgatgcgaagcgccagtttcaacacagatccctacgtgcgtgaattcggcatcatggtcaaagatgagatgacagacgtgaccgggcgggtcctccagccaccctccatcctctacgggggcaggaacaaggcgattgccacccctgtgcagggtgtctgggacatgcggaacaagcagtttcacacgggcatcgagatcaaggtgtgggccatcgcctgctttgccccccagcgccaatgcactgaagtccacctgaagtccttcacagagcagctgcgcaagatctccagggacgccgggatgcccatccagggccagccgtgtttctgcaagtacgcccagggcgccgacagtgtggagcccatgttccgccacctcaagaacacctacgccggcctgcagctggtcgtggtcatcctgccgggaaagacccctgtctatgctgaagtgaagcgtgtgggtgacaccgtgctggggatggccacgcagtgtgtgcagatgaagaacgtgcagcggaccaccccgcagaccctgtccaacctctgcctgaagatcaacgtcaagctgggaggggtgaacaacatcctgctgccccagggcaggcctccagtcttccagcagccggtcatcttcctgggtgccgacgtcacccacccgcccgctggagacgggaagaagccttcaatcgctgctgtcgtgggcagcatggatgcccaccccaaccgctactgtgccaccgtgcgtgtgcagcagcaccggcaggagatcatccaggacctggcagccatggtgcgcgagctgctcatccagttctacaagtccacgcgcttcaagcccacacgcatcatcttctaccgagacggcgtctccgagggccagttccagcaggtcctgcaccacgagctgctggccatccgagaggcctgcatcaagctggagaaggactaccagccggggatcaccttcatcgtggtccagaaacgccaccacacccgcctcttctgcaccgacaagaacgagcgggtcgggaagagtggaaacatcccagcaggcaccactgtggacacaaagatcacccacccaaccgagtttgatttctacctgtgcagccacgccggcatccagggcacaagccggccctcccactaccacgtcctgtgggacgacaaccggttctcctccgacgagctgcaggtcctcacctaccagctgtgccacacctacgtgcgctgcacgcgctccgtgtccatccctgcgcctgcctactatgcccatctggtggccttccgggccaggtaccacctggtggacaaggagcatgacagtgcggaaggaagccatacctctgggcagagcaacggccgagaccaccaggccctggccaaggccgtgcaggtccaccaggacacgctgcgcaccatgtacttcgcctgacgtgtccgagtgcttgcgacggcataccgagttggattcacacgagaccagctacactcagaccaacagcccagccccccgagacagccagccttggaccatgagacgcccctgcgttcccagactcccacggcccaggaggcctttcgtcccagatttcaaactcggattttgaactgcagacctgtatgaga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]