LOCUS       XM_004665225            3526 bp    mRNA    linear   ROD 16-NOV-2021
DEFINITION  PREDICTED: Jaculus jaculus argonaute RISC component 1 (Ago1),
            transcript variant X1, mRNA.
ACCESSION   XM_004665225
VERSION     XM_004665225.3
DBLINK      BioProject: PRJNA778790
KEYWORDS    RefSeq.
SOURCE      Jaculus jaculus (lesser Egyptian jerboa)
  ORGANISM  Jaculus jaculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Dipodoidea; Dipodidae; Dipodinae; Jaculus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_059106.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Nov 16, 2021 this sequence version replaced XM_004665225.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Jaculus jaculus Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3526
                     /organism="Jaculus jaculus"
                     /mol_type="mRNA"
                     /isolate="mJacJac1"
                     /db_xref="taxon:51337"
                     /chromosome="5"
                     /sex="male"
                     /tissue_type="liver, spleen"
                     /dev_stage="adult"
                     /country="USA: San Diego"
                     /lat_lon="32.72 N 117.17 W"
                     /collection_date="2021-06-15"
                     /collected_by="Kimberly Cooper"
     gene            1..3526
                     /gene="Ago1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 34 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 4 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:101613742"
     CDS             111..2684
                     /gene="Ago1"
                     /codon_start=1
                     /product="protein argonaute-1 isoform X1"
                     /protein_id="XP_004665282.1"
                     /db_xref="GeneID:101613742"
                     /translation="

MEAGPSGAAAGTYLPPLQQVFQAPRRPGIGTVGKPIKLLANYFEVDIPKIDVYHYEVDIKPDKCPRRVNREVVEYMVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWLAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHISGQSNGRDPQALAKAVQVHQDTLRTMYFA"

     misc_feature    210..602
                     /gene="Ago1"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    630..782
                     /gene="Ago1"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    783..1145
                     /gene="Ago1"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(939..941,984..986,1026..1028,1038..1040,1092..1094,
                     1113..1115,1119..1121)
                     /gene="Ago1"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1278..2555
                     /gene="Ago1"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1689..1691,1701..1703,1737..1748,1755..1757,
                     1779..1781,1788..1790,1800..1802,1812..1814)
                     /gene="Ago1"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1893..1895,1899..1901,2109..2111,2523..2525)
                     /gene="Ago1"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      

ccgagcccggcccgggagcccgagcagcccgtgtgcgtggtagctaggccccccttcacgctggacccccacagtctccgggccgcctgacctccgcacgggtatatgggatggaagcgggaccctcgggagcagctgcgggcacctacctgccccccctgcagcaggtgttccaggcacctcgaaggcctggcattggtactgtggggaaaccaatcaagcttctggccaattactttgaggtggacattcctaaaatcgacgtttaccactacgaggtggacatcaagccggataagtgtccccgcagagtcaatcgggaagtggtggaatacatggtccagcatttcaagcctcagatctttggtgaccgcaagcctgtgtatgatggcaagaagaacatttacactgtcactgcactgcccattggcaatgaacgggttgactttgaggtgaccatccctggggaagggaaagatcgaatttttaaggtgtctatcaagtggctagccattgtgagctggcgtatgttgcatgaagctttggtcagtggacagatccccgtgcccttggagtctgtgcaagccttggatgtggccatgagacacctggcatcaatgaggtacacccccgtgggccgctccttcttctcaccgcctgagggctactaccacccgctggggggtgggcgcgaggtctggttcggctttcaccagtctgtgcgccctgccatgtggaagatgatgctcaacatcgatgtctcagccactgccttctacaaggcacagccagtgattgagttcatgtgtgaggtgctagacatcaggaacatagatgaacaacccaagcccctcacggactcccagcgtgttcgctttaccaaggagatcaagggtctgaaggtggaagtgacccactgtggacagatgaagaggaaataccgtgtgtgtaatgtcacccgccgccctgctagccatcagacgtttcccttgcagctggagagtggacagactgtggaatgcacagtggcacagtatttcaagcagaaatacaaccttcagctcaagtatccccatttgccctgcctccaagttggccaagaacaaaaacatacctatcttccccttgaggtctgtaacattgtggctgggcagcgctgcattaagaagctgactgacaaccagacttcgaccatgataaaggctacagctaggtcggccccagacagacaggaggagatcagtcgtctgatgaagaatgccagctacaacctcgacccctacattcaggaattcgggatcaaggtgaaggacgacatgacggaggtgacaggacgcgtgctgccggcgcccatcctgcagtacggcggccggaaccgggccattgctacacccaaccaaggtgtctgggacatgcgggggaagcagttctacaatgggattgagatcaaagtctgggccatcgcctgctttgcaccccaaaaacaatgtcgagaagaggtgctcaagaacttcacagaccagctgcggaagatttccaaggatgcaggaatgcccatccagggtcagccttgcttctgcaagtacgcgcagggggcagacagcgtggagcccatgttccggcatctgaagaatacctactcagggctgcagctcattatcgtcatcctgccagggaagacgcccgtgtatgctgaagtgaaacgtgttggagatacactcttgggaatggcaacgcagtgtgtgcaggtgaagaacgtggtcaagacctctcctcagactctgtccaacctctgcctcaagatcaatgtcaaacttggtggcattaacaacatcctagtcccacaccagcgctctgctgtctttcaacagccagtgatattcctgggagcagatgtcacacatcccccagcaggggatgggaaaaagccgtctatcacagcagtggtaggcagtatggatgcccaccccagccgatactgcgctactgtgcgggtacagcgaccacggcaggagatcatcgaagacttgtcctatatggtgcgtgaactgctcatccaattctacaagtccacccgcttcaaacctactcgcatcatcttttaccgagacggagtccccgaaggccagcttcctcagatcctccactatgagctgcttgccattcgtgacgcctgcatcaagctggaaaaggactatcaacctgggatcacttacattgtggtgcagaaacgccatcacacccgccttttctgtgctgacaagaacgagcgaattgggaagagtggtaacatcccagctgggaccactgtggacaccaacatcacccacccatttgagttcgacttctatctgtgcagtcacgcaggcatacagggcaccagccggccatcccattactacgttctgtgggatgataaccgtttcactgcggacgagctccagatcttgacataccagctgtgccacacttacgtacgatgcacacgttctgtctctatcccagcacctgcctactatgcccgcttggtggctttccgagcacgataccacctggttgacaaggaacatgacagtggagaggggagccacatatccgggcagagcaatgggcgggaccctcaggccctggccaaagctgtgcaggttcaccaggacactctgcgcaccatgtacttcgcttgaaggcagaacgctgtgacctcactggatagaagaaagctttccaagccccccaccctggagctgtgccgcccaaatccacaggaagcaaggaagagggaggcggggaagggagcagtggaggaggccttgtttctttctaccgacggggtgtaagggtggggaacagggccagcaagacagaccaccagccagaaatctcttacaccaacctcatgtcctccgaccctcacccatcttgtcatatctggccctggcccctctggactaagaggggcagcactggtgcccaccatacacacaggtgtctcatgtgactcacagtgctaaagactcatgcttgacagcttggtcaggtcagctctgcagccctgcggacaaaagctggtaggtttgggtttcatcctttaggtgggaaagtgaggggcttgagaaagtgggtgggaagagggaaggaaattttaggagccttaatcagaaaaggtctagatttgtttaagaaaaatgaaacccaacccagatcaatattttaggatactagatgttttcatgggttcagaatccagtttgtaggaagatttttaatgctaatggttttggttgctcctcccccagccgccaccctcccctgctacccttattcctccctctccacctttgctcccccactttcaccttatgcctcttccctgacagacatccagccccctagtaacacttgaggcactatggcacttagctctgaagtgacacgaccctgtcttccttccgcctgctggtgggtaaccagtgccttccctgtaatggttatgctgcagaaccgcaaccttttgtacctttctttg

//