GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 05:51:15, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XM_003500671            4947 bp    mRNA    linear   ROD 10-JUL-2020
DEFINITION  PREDICTED: Cricetulus griseus testis and ovary specific PAZ domain
            containing 1 (Topaz1), transcript variant X1, mRNA.
ACCESSION   XM_003500671
VERSION     XM_003500671.3
DBLINK      BioProject: PRJNA72741
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Cricetulus griseus (Chinese hamster)
  ORGANISM  Cricetulus griseus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Cricetidae; Cricetinae; Cricetulus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_003613803.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jul 10, 2020 this sequence version replaced XM_003500671.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Cricetulus griseus Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 1% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..4947
                     /organism="Cricetulus griseus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10029"
                     /chromosome="Unknown"
                     /cell_line="CHO-K1"
     gene            1..4947
                     /gene="Topaz1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 Proteins"
                     /db_xref="GeneID:100765807"
     CDS             1..4947
                     /gene="Topaz1"
                     /codon_start=1
                     /product="protein TOPAZ1 isoform X1"
                     /protein_id="XP_003500719.1"
                     /db_xref="GeneID:100765807"
                     /translation="
MRPVTSSAATMDGDARGLRKRSLQLTPEPDKVGGCSLEARGREEESRQKRRAVAQASGGEATEGDKLAKEKGNISEAPSEDPQPGTDLVRKAALTSSESLQTVECSEFQNMAFLQSLAKEDLVEGIKRRIRIKKCKSLENLPLRITKNEAAQNTNVEFQDELYKNTPKYSCSSLSPGVEKHCSFESHDYSFLHSEGLNNENNFECKPHGVCMHIAENSLKLKKENLRSLAEKDGPETTAKLLKTEENVIASKLLLEESNLYQNKNNGLISCLQSEKSKYSIEESGIGRKHRKKVKLSEKEEKIIDLDFSNVNNNSELVLQENQMGAEGKETETSEPKKSFLKALRKINHNILSPVDHLCLPETVGKTSPKHQVNAVFQKTLESHLKEDIKNASESLGCRSVEPEDYFKSMISSAVKSPSDSHHMGKRSPWGDLRNETEESKVSCRRIIPMTGKRTWPFYSCARISVQCWKKTCLSDLNYPLPGSLENVRQHESVTHQTHLTDSKLLQQSLTERTIESSRKEMYDSGLNCLSSVSSVTPTLMVIKEAIPSDKKIKLEEPSRNGTEVVSSATEDTQLTNVTQSLTGNKKKRGNLSKLNLTMASQESQEANSFANKTIHRKACISKQTLVAPDLVKILNTGRLTNFKIPLLKNKMGKRKEVNSRSCEREAYSPLELLDSLSGVEAKQNRNKENICTATSGPQSLNVHSSVTPGEAGSHSFYNKTSCTAPSFAKKGYDNKAYSHISEPGNIISNKESISLKIENNTFSCDLGYIEQSSFCSEEQEAFVPISSEVSGRKMTKSISELKLGFPDILKAYEDDVLLIDVIQDDPELFGISSEGDLSFASEVSKISQEPSVSEEHPQADFKHMQLPGKKEPGDLSKEVALLDPGLLKLEICPSLSAAEESQRDPKGAAISLEAAEETIVSENLEDLSEQARASDSGAQCSSSDNAAAEEEQENTQEVCKSKESKDAEVVVNECQLAILGPKPLCSSVLPLKLSSHQENGVPMPWMNDFRFPGRPSSVLQLQNSETCEIFKREKNTGVFQKPLGLVIPHRYCKFHFNTLRGCERAQCKFVHVPEQGDEKICVDVFKKYISLDEQRLLQRAAHIFLEYYRKFPPGVHFSLQVLNDLLIALLKHCLLKEVFQVVKLSTMAKVLPALKILLKIFEYVAAMKLRNAVPALIEIFCKFIEAGMVPDSEHLNYIVKLLYQAQASHQDIAAVLEAKSRLRVRQLKKTWKCDLDSALSEVETCKEKGDWTKLGNLYISIKMGCEEFADFQRFCACVAESLTKDCKEEWPGVPFCEFAETVSKDPQFSEVDKTLLGRIGINAMYFYHRLMLWSKGRMVLDTLYELKIHFTSLKGLTGPEKVAPRCQIVNVAVEIFIKSGSLDGAIWVLRESEWIINTPLWPCDRMDVLNRHNLLCTIAHETLGKNLYRQTFEVLRNLPGFQNSQETVEVSQYSLLFNKLLDACIESSSLGISSSVAEFMVSKSIPIDFSFLRRLITALGRSCLWLKARAHYKSALSLGCYPPLEGNLYRKLLLVPSYLSEIEMLLAIEIFLVSNASSIQSPGTSTQMLQIVLKRCEESKSRSKDDYQAAVERLIMAARISDPKLFIKHMTVNINKEQVYSLEHCSALKWLKENMKWAGKVWLFTNH"
     misc_feature    3556..4257
                     /gene="Topaz1"
                     /note="Putative aspartate racemase; Region:
                     Asp_Glu_race_2; pfam14669"
                     /db_xref="CDD:291341"
ORIGIN      
atgcggcctgtcacctccagcgcggcgacgatggacggcgacgcccgaggcctgaggaagcgaagtcttcagctgacaccagagccagacaaggtgggaggctgcagccttgaggcccgggggcgcgaggaggagagcaggcagaagaggagagcggtggcccaggcctctggaggagaagcgacagaaggtgacaagttggccaaagagaaaggaaacatttctgaagctccaagtgaagatccacagccagggactgacctggtaagaaaggcagcattaaccagttcggaatctttgcaaacagtggaatgcagtgaatttcagaatatggctttcttacagtctttggctaaggaagatttggtagaaggtattaaaagaagaattcgaattaagaaatgcaaaagtttagaaaacctacctctcagaataactaagaacgaggcagcacaaaatactaatgttgagttccaagatgaactgtacaagaatactccaaaatattcttgtagcagcttatcacctggagtagaaaaacattgcagttttgagtcacatgattacagtttcctccattctgagggtcttaataatgaaaacaactttgagtgtaaacctcacggtgtgtgtatgcacatagcggagaattcattgaagttaaagaaagaaaaccttaggagtcttgcagagaaggatggcccagaaactactgctaagctcttaaaaactgaagaaaatgtaatagccagtaaattactgcttgaagaaagtaatttataccaaaataaaaacaatggcttgatttcttgccttcaaagtgaaaaaagcaaatattcaatagaggagagcggcattgggagaaaacacaggaagaaggtgaaactgtctgaaaaagaagaaaaaattattgatcttgatttctctaatgtaaataacaattctgagttagtgctacaagaaaaccaaatgggtgcagaagggaaagaaacagagacctcagagcctaaaaagagttttctaaaagctttaagaaaaataaaccataatatactctctccagtggaccatttatgtcttccagaaacagtagggaaaacaagtcccaaacatcaagtaaatgctgtgtttcagaaaacccttgaatcacatttgaaagaggatattaaaaatgcttcagagtccttaggatgcagaagtgtggagccagaagattattttaaatccatgataagctctgcagtgaagtcacctagtgatagccatcacatggggaaaagatctccatggggagatttgagaaatgaaactgaagagtcaaaggtaagctgtcgcagaataataccaatgactggtaaaagaacgtggcctttttattcttgtgctagaatatcagtccagtgttggaaaaagacttgcctgtcagatttaaattacccgcttccagggtctctggaaaatgttaggcaacatgaatctgtcacacaccaaactcacttaactgactccaaactgttacaacagtccttaacagaaagaaccattgagtcctcaaggaaagaaatgtatgattctggtttaaattgtttgtcttcagtttcttcagtcacacctactttgatggttataaaggaagccatacccagtgataaaaagataaagttagaggaacctagcagaaatgggacagaggtagtttctagtgctactgaagacacccagctaactaatgtaactcaaagcttaacaggaaataagaaaaagagagggaatttatccaaacttaatttgaccatggcatcccaagagagccaggaagcaaatagctttgcaaacaaaactatccatcgaaaagcttgcattagtaagcaaacacttgtggctccagacttagttaaaatattaaacacaggacggctgactaattttaaaatccctttactgaagaacaagatgggaaaaagaaaagaagtaaattccagatcatgtgagagagaagcttacagtcccctagagctactagacagtttatctggagtagaagcaaaacaaaacaggaataaggaaaatatctgcacagcaacttcgggacctcagtctctgaatgtacatagtagtgtaactccaggggaagctggttctcactcattctacaataagacttcctgcactgctccaagctttgcaaagaaaggttatgataataaagcatatagtcacatctctgaaccaggcaatattatttctaataaggagtctatttctcttaaaattgaaaataataccttttcttgtgatcttgggtatattgagcaaagttcattctgctctgaggaacaagaagcatttgtgccaatttcttctgaagttagtggtagaaaaatgactaaaagcatttcagaactcaaattggggtttccagatatccttaaagcatatgaagatgatgtcctcttgattgatgtaattcaagatgacccagagctctttggaatctccagtgaaggggatctctcatttgcttcagaagtctccaagataagccaggagcccagtgtatctgaagagcacccacaagcagactttaagcacatgcaacttccagggaaaaaagaaccaggcgatttgagtaaagaagttgccttgctggaccctggattgctgaaactggagatctgtccttccttgtcagcagcagaggagtcgcagcgtgatcctaaaggtgcagccatctccttagaagccgctgaggagactattgtaagtgagaacctggaagacctcagtgaacaagcgagagcttcagactcgggtgcacagtgcagcagttcagacaacgcagctgctgaagaagagcaagagaacactcaggaagtttgcaaaagcaaagagtctaaagatgcagaggttgtggtaaatgaatgtcagttagcaatcctgggccccaaacctctctgctcatcggtgcttcctttgaagctaagcagccatcaggaaaatggagtgccaatgccctggatgaatgatttcagatttccaggaagaccttcttctgtcctacagctgcagaattctgaaacttgtgaaatatttaaaagagaaaaaaatacaggggtgttccagaagcccttagggttggtgataccccatagatactgcaaatttcattttaatacattgcgtggctgtgaaagagcacagtgcaagtttgtccatgtacctgagcagggagatgaaaagatctgtgtggatgtgtttaagaaatacataagccttgatgagcagcgtttgctacagagagcagcacacatattcctggagtactacagaaagtttcccccaggggtacacttcagtctacaagtcctgaatgaccttctgatcgctctactcaagcactgtttattgaaagaagtctttcaggtggtgaagctgagcacaatggctaaagtgctgcctgccctgaaaatattactaaaaatatttgagtacgtggcagctatgaagttaaggaacgctgtgcctgcattaattgagattttttgcaagttcattgaagctgggatggtacctgactcagagcacttgaactatattgtcaagctgttataccaagcacaggcatcccatcaagacatagctgcagttctggaagccaagtccaggttacgagtgaggcaactgaaaaagacctggaagtgtgatttagactcagccttgagtgaagtggagacttgtaaagaaaaaggtgactggaccaaattgggaaacctgtatattagcataaaaatgggctgtgaagaatttgcagatttccagagattctgtgcttgtgttgctgaaagcctcacaaaggattgcaaagaagaatggccaggtgttcctttttgtgagtttgctgaaacagttagcaaagatccacagttcagtgaggtggataagactttgttgggaaggatcggaataaatgctatgtacttctatcacagactgatgctatggtccaagggaaggatggtcttagatacactgtatgagctaaaaatacattttacaagtttaaaaggacttacgggacctgagaaagtggcaccacgatgtcaaattgtgaatgttgcagtggaaatttttatcaaaagtgggagccttgatggtgccatttgggtgctgagggaatcggaatggataatcaatacaccactttggccttgtgatagaatggatgtgcttaatcggcataatttgctctgtactattgcacatgagaccctgggcaagaatctttacagacagacatttgaagttttgaggaatctgccaggctttcagaattctcaagaaactgtggaggtttcccagtatagccttctttttaataaacttctagatgcctgtatagaaagtagcagtcttggcatatcatcttctgtagccgagttcatggtttcgaaaagcatccctattgacttttcctttctcaggagactaatcactgccttaggaaggagttgtctgtggctcaaagccagagcccactacaaaagtgctctttcactgggttgctacccaccattagagggaaacttataccggaaactcctattggttccttcttacttgtctgagattgaaatgcttttagctatcgaaatatttctggtgtctaatgctagcagtattcagagcccagggacttccacacagatgctacagatcgttttgaagagatgtgaagaaagcaaatctcgaagcaaggatgactatcaagctgcagtcgaaagattgatcatggctgctcgaatatcagaccccaagctcttcattaagcacatgaccgtcaatattaacaaggagcaggtgtatagcctggagcattgttctgccctgaaatggttgaaagagaatatgaagtgggctggaaaggtttggcttttcactaaccattag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]