ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-07-18 13:31:15, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_003382049 402 bp mRNA linear INV 01-JUL-2011
DEFINITION Trichinella spiralis retrotransposon gag protein (Tsp_08954) mRNA,
complete cds.
ACCESSION XM_003382049
VERSION XM_003382049.1
KEYWORDS RefSeq.
SOURCE Trichinella spiralis
ORGANISM Trichinella spiralis
Eukaryota; Metazoa; Ecdysozoa; Nematoda; Enoplea; Dorylaimia;
Trichinellida; Trichinellidae; Trichinella.
REFERENCE 1 (bases 1 to 402)
AUTHORS Mitreva,M., Jasmer,D.P., Zarlenga,D.S., Wang,Z., Abubucker,S.,
Martin,J., Taylor,C.M., Yin,Y., Fulton,L., Minx,P., Yang,S.P.,
Warren,W.C., Fulton,R.S., Bhonagiri,V., Zhang,X.,
Hallsworth-Pepin,K., Clifton,S.W., McCarter,J.P., Appleton,J.,
Mardis,E.R. and Wilson,R.K.
TITLE The draft genome of the parasitic nematode Trichinella spiralis
JOURNAL Nat. Genet. 43 (3), 228-235 (2011)
PUBMED 21336279
REFERENCE 2 (bases 1 to 402)
AUTHORS Mitreva,M., Wang,Z., Abubucker,S., Martin,J., Taylor,C., Fulton,L.,
Minx,P., Wesley,C., Warren,C., Fulton,R., Pepin,K.H., Bhonagiri,V.,
Zhang,X.W.E., Clifton,S., Mardis,E.R. and Wilson,R.K.
TITLE Direct Submission
JOURNAL Submitted (11-MAR-2010) Genome Sequencing Center, Washington
University School of Medicine, 4444 Forest Park, St. Louis, MO
63108, USA
REFERENCE 3 (bases 1 to 402)
AUTHORS Wilson,R.K.
TITLE Direct Submission
JOURNAL Submitted (16-OCT-2007) Genome Sequencing Center, Washington
University School of Medicine, 4444 Forest Park Parkway, St. Louis,
MO 63108, USA
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. This record is derived from an annotated genomic
sequence (NW_003526940).
Trichinella spiralis is a roundworm that cause most of the human
trichinella infections and deaths around the world. Its
pathogenicity is higher than that of other trichinella species due
to the higher number of newborn larvae produced by the females and
for the stronger immune reaction induced in humans. The life cycle
of the parasite begins when a person or an animal eats contaminated
meat containing larvae. T. spiralis is a basal nematode with a
well-defined phylogenetic position near the root of the phylum
Nematoda. The genome size estimate based on flow sorted nuclei
stained with PI (Spencer Johnston, Texas A&M University) is 1C =
71.3 +/1 1.2 Mb. The strain being sequenced (ISS 195) was obtained
from the laboratory of Judith Appleton (Cornell University) and has
been maintained in rats since 1970. Worm isolation and DNA
extraction was performed by Dante Zarlenga (USDA)
This assembly consists of plasmid, fosmid and BAC end sequences.
The data were assembled using the assembly engine, PCAP (Xiaoqiu
Huang et. al. 2006). Our goal is to explore this WGS draft sequence
of T. spiralis in several ways: i) to provide a better
understanding of evolutionary biology by identifying gene loss or
gain across the phylum Nematoda and clarify evolution of genome
architecture (synteny, operons); ii) help identify RNA genes and
regulatory regions; and iii) better define proteins involved in
nematode parasitism that impact health and disease and are relevant
to both host-parasite relationships and basic biological
processes..
We masked the repeats by using RECON (Bao and Eddy, 2002) and
RepeatMasker (A.F.A. Smit, R. Hubley & P. Green RepeatMasker at
http://repeatmasker.org). Then the Ribosomal RNA genes were
identified using RNAmmer
((http://www.cbs.dtu.dk/cgi-bin/nph-sw_request?rnammer ). Transfer
RNA genes were identified with tRNAscan-SE (Lowe and Eddy, 1997).
Non-coding RNAs, such as microRNAs, were identified by sequence
homology search of the Rfam database
(http://selab.janelia.org/software.html). Protein-coding genes were
predicted using a combination of ab initio programs (Snap, Korf,
2004 and Fgenesh, Softberry, Corp) and an inhouse evidence based
program Eannot (Eannot Ding et al., 2004) which uses mRNA, EST and
protein alignment information from same species or cross-species to
aid in gene structure determination. A consensus gene set from the
above prediction algorithms will be generated, using a logical,
hierarchical approach. Gene product naming was determined by BER
(JCVI: http://ber.sourceforge.net ).
For information regarding this assembly or project, or any other
GSC genome project, please visit our Genome Groups web page
(http://genome.wustl.edu/genome_group_index.cgi) and email the
designated contact person. For specific questions regarding the T.
spiralis genome project contact Makedonka Mitreva
mmitreva@watson.wustl.edu (Washington University School of
Medicine). The National Human Genome Research Institute (NHGRI) of
the National Institutes of Health (NIH) provided funds for this
project.
FEATURES Location/Qualifiers
source 1..402
/organism="Trichinella spiralis"
/mol_type="mRNA"
/strain="ISS 195"
/db_xref="taxon:6334"
/chromosome="Unknown"
gene 1..402
/locus_tag="Tsp_08954"
/db_xref="GeneID:10902500"
CDS 1..402
/locus_tag="Tsp_08954"
/codon_start=1
/product="retrotransposon gag protein"
/protein_id="XP_003382097.1"
/db_xref="GeneID:10902500"
/translation="
MPSAYRGDYYRPPHAFRPEMDSVEWLERLEDFLCLSRVPPSDHGMAARYLLSDSVHRELYPAGQTRGDSFEEFKKRLLDAYGPEESTGRLIERFHAMHQREGKTIEQYAQEMAEVERRAGVTERDLVRVSPGE"
misc_feature 166..384
/locus_tag="Tsp_08954"
/note="Retrotransposon gag protein; Region:
Retrotrans_gag; cl46289"
/db_xref="CDD:480629"
ORIGIN
atgccatcggcgtaccgaggtgactactatcgcccgccccatgcttttcgtccggagatggattccgtcgaatggctggagaggctggaagacttcctctgcctcagcagggttccgccttctgaccacggcatggccgctcgctatcttcttagcgactcagttcaccgcgagctctacccggcaggacaaacaagaggggattccttcgaagagttcaagaagagattgctggacgcgtacggcccggaagagtcgacagggcggctgatcgaacggttccacgccatgcaccaacgcgagggcaaaaccatcgaacaatacgcccaggagatggcggaagttgaacgcagagccggcgtaacagaacgtgatctcgtgcgcgtttcgccgggggaataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]