GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-07-18 13:31:15, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_003382049             402 bp    mRNA    linear   INV 01-JUL-2011
DEFINITION  Trichinella spiralis retrotransposon gag protein (Tsp_08954) mRNA,
            complete cds.
ACCESSION   XM_003382049
VERSION     XM_003382049.1
KEYWORDS    RefSeq.
SOURCE      Trichinella spiralis
  ORGANISM  Trichinella spiralis
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Enoplea; Dorylaimia;
            Trichinellida; Trichinellidae; Trichinella.
REFERENCE   1  (bases 1 to 402)
  AUTHORS   Mitreva,M., Jasmer,D.P., Zarlenga,D.S., Wang,Z., Abubucker,S.,
            Martin,J., Taylor,C.M., Yin,Y., Fulton,L., Minx,P., Yang,S.P.,
            Warren,W.C., Fulton,R.S., Bhonagiri,V., Zhang,X.,
            Hallsworth-Pepin,K., Clifton,S.W., McCarter,J.P., Appleton,J.,
            Mardis,E.R. and Wilson,R.K.
  TITLE     The draft genome of the parasitic nematode Trichinella spiralis
  JOURNAL   Nat. Genet. 43 (3), 228-235 (2011)
   PUBMED   21336279
REFERENCE   2  (bases 1 to 402)
  AUTHORS   Mitreva,M., Wang,Z., Abubucker,S., Martin,J., Taylor,C., Fulton,L.,
            Minx,P., Wesley,C., Warren,C., Fulton,R., Pepin,K.H., Bhonagiri,V.,
            Zhang,X.W.E., Clifton,S., Mardis,E.R. and Wilson,R.K.
  TITLE     Direct Submission
  JOURNAL   Submitted (11-MAR-2010) Genome Sequencing Center, Washington
            University School of Medicine, 4444 Forest Park, St. Louis, MO
            63108, USA
REFERENCE   3  (bases 1 to 402)
  AUTHORS   Wilson,R.K.
  TITLE     Direct Submission
  JOURNAL   Submitted (16-OCT-2007) Genome Sequencing Center, Washington
            University School of Medicine, 4444 Forest Park Parkway, St. Louis,
            MO 63108, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_003526940).
            Trichinella spiralis is a roundworm that cause most of the human
            trichinella infections and deaths around the world. Its
            pathogenicity is higher than that of other trichinella species due
            to the higher number of newborn larvae produced by the females and
            for the stronger immune reaction induced in humans. The life cycle
            of the parasite begins when a person or an animal eats contaminated
            meat containing larvae. T. spiralis is a basal nematode with a
            well-defined phylogenetic position near the root of the phylum
            Nematoda. The genome size estimate based on flow sorted nuclei
            stained with PI (Spencer Johnston, Texas A&M University) is 1C =
            71.3 +/1 1.2 Mb. The strain being sequenced (ISS 195) was obtained
            from the laboratory of Judith Appleton (Cornell University) and has
            been maintained in rats since 1970. Worm isolation and DNA
            extraction was performed by Dante Zarlenga (USDA)
            
            This assembly consists of plasmid, fosmid and BAC end sequences.
            The data were assembled using the assembly engine, PCAP (Xiaoqiu
            Huang et. al. 2006). Our goal is to explore this WGS draft sequence
            of T. spiralis in several ways: i) to provide a better
            understanding of evolutionary biology by identifying gene loss or
            gain across the phylum Nematoda and clarify evolution of genome
            architecture (synteny, operons); ii) help identify RNA genes and
            regulatory regions; and iii) better define proteins involved in
            nematode parasitism that impact health and disease and are relevant
            to both host-parasite relationships and basic biological
            processes..
            
            We masked the repeats by using RECON (Bao and Eddy, 2002) and
            RepeatMasker (A.F.A. Smit, R. Hubley & P. Green RepeatMasker at
            http://repeatmasker.org). Then the Ribosomal RNA genes were
            identified using RNAmmer
            ((http://www.cbs.dtu.dk/cgi-bin/nph-sw_request?rnammer ). Transfer
            RNA genes were identified with tRNAscan-SE (Lowe and Eddy, 1997).
            Non-coding RNAs, such as microRNAs, were identified by sequence
            homology search of the Rfam database
            (http://selab.janelia.org/software.html). Protein-coding genes were
            predicted using a combination of ab initio programs (Snap, Korf,
            2004 and Fgenesh, Softberry, Corp) and an inhouse evidence based
            program Eannot (Eannot Ding et al., 2004) which uses mRNA, EST and
            protein alignment information from same species or cross-species to
            aid in gene structure determination. A consensus gene set from the
            above prediction algorithms will be generated, using a logical,
            hierarchical approach. Gene product naming was determined by BER
            (JCVI: http://ber.sourceforge.net ).
            
            For information regarding this assembly or project, or any other
            GSC genome project, please visit our Genome Groups web page
            (http://genome.wustl.edu/genome_group_index.cgi) and email the
            designated contact person. For specific questions regarding the T.
            spiralis genome project contact Makedonka Mitreva
            mmitreva@watson.wustl.edu (Washington University School of
            Medicine). The National Human Genome Research Institute (NHGRI) of
            the National Institutes of Health (NIH) provided funds for this
            project.
FEATURES             Location/Qualifiers
     source          1..402
                     /organism="Trichinella spiralis"
                     /mol_type="mRNA"
                     /strain="ISS 195"
                     /db_xref="taxon:6334"
                     /chromosome="Unknown"
     gene            1..402
                     /locus_tag="Tsp_08954"
                     /db_xref="GeneID:10902500"
     CDS             1..402
                     /locus_tag="Tsp_08954"
                     /codon_start=1
                     /product="retrotransposon gag protein"
                     /protein_id="XP_003382097.1"
                     /db_xref="GeneID:10902500"
                     /translation="
MPSAYRGDYYRPPHAFRPEMDSVEWLERLEDFLCLSRVPPSDHGMAARYLLSDSVHRELYPAGQTRGDSFEEFKKRLLDAYGPEESTGRLIERFHAMHQREGKTIEQYAQEMAEVERRAGVTERDLVRVSPGE"
     misc_feature    166..384
                     /locus_tag="Tsp_08954"
                     /note="Retrotransposon gag protein; Region:
                     Retrotrans_gag; cl46289"
                     /db_xref="CDD:480629"
ORIGIN      
atgccatcggcgtaccgaggtgactactatcgcccgccccatgcttttcgtccggagatggattccgtcgaatggctggagaggctggaagacttcctctgcctcagcagggttccgccttctgaccacggcatggccgctcgctatcttcttagcgactcagttcaccgcgagctctacccggcaggacaaacaagaggggattccttcgaagagttcaagaagagattgctggacgcgtacggcccggaagagtcgacagggcggctgatcgaacggttccacgccatgcaccaacgcgagggcaaaaccatcgaacaatacgcccaggagatggcggaagttgaacgcagagccggcgtaacagaacgtgatctcgtgcgcgtttcgccgggggaataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]