GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-02-27 21:13:33, GGRNA.v2 : RefSeq release 98 (Jan, 2020)

LOCUS       XM_003025663            2982 bp    mRNA    linear   PLN 12-AUG-2010
DEFINITION  Trichophyton verrucosum HKI 0517 RNA interference and gene
            silencing protein (Qde2), putative, mRNA.
ACCESSION   XM_003025663
VERSION     XM_003025663.1
KEYWORDS    RefSeq.
SOURCE      Trichophyton verrucosum HKI 0517
  ORGANISM  Trichophyton verrucosum HKI 0517
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Eurotiomycetes; Eurotiomycetidae; Onygenales; Arthrodermataceae;
            Trichophyton.
REFERENCE   1  (bases 1 to 2982)
  AUTHORS   Burmester,A., Shelest,E., Gloeckner,G., Heddergott,C.,
            Schindler,S., Staib,P., Felder,M., Petzold,A., Szafranski,K.,
            Monod,M., Winkler,R., Kniemeyer,O., Schroeckh,V., Hertweck,C.,
            Platzer,M., Guthke,R., Heitman,J., Wostemeyer,J., Zipfel,P.F. and
            Brakhage,A.A.
  CONSRTM   Arthroderma Genome Sequencing Consortium
  TITLE     Dermatophyte fungi deploy unique virulence strategies to cause
            cutaneous infection
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 2982)
  AUTHORS   Burmester,A., Shelest,E., Gloeckner,G., Heddergott,C.,
            Schindler,S., Staib,P., Felder,M., Petzold,A., Szafranski,K.,
            Monod,M., Winkler,R., Kniemeyer,O., Schroeckh,V., Hertweck,C.,
            Platzer,M., Guthke,R., Heitman,J., Wostemeyer,J., Zipfel,P.F. and
            Brakhage,A.A.
  CONSRTM   Arthroderma Genome Sequencing Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (04-SEP-2009) Leibniz Institute for Natural Product
            Research and Infection Biology - Hans Knoell Institute (HKI),
            Beutenbergstrasse 11a, Jena 07743, Germany
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_003315632).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..2982
                     /organism="Trichophyton verrucosum HKI 0517"
                     /mol_type="mRNA"
                     /strain="HKI 0517"
                     /db_xref="taxon:663202"
     gene            <1..>2982
                     /locus_tag="TRV_00123"
                     /db_xref="GeneID:9581952"
     CDS             1..2982
                     /locus_tag="TRV_00123"
                     /codon_start=1
                     /product="RNA interference and gene silencing protein
                     (Qde2), putative"
                     /protein_id="XP_003025709.1"
                     /db_xref="GeneID:9581952"
                     /translation="
MSERGGYRGRGRGGGDRGDRGGSRGRGGGGRGGRGGRGGGDFDGGRGRATFTGGRGGRGGGGRGRGGSPSIYGEGHPVPPPDAEVQKIEDTYIKQRKGLSLDTLKLSQAFPLRPAYGTRGNPVVLWANYFPLVPQTGITLYRYTVNVGVEGKQPPGYRKLKRIFEILLEDHLSAFQGHIATDFKATLISTTSLDLTSESLEVAYRDEFDAVAEPNAPRYPLRIVEIAPLVLDELLKFLKSPGADAFGQSKEEYLQALNIVTGHFPKISLDTFNVGPNKHFKTKTKDIFDLGGGLNAYRGYFVSTRAATSRLLVNVQVKHTTCFYDGPLVNLMTSTHNLFGLKQMNNLLKGVKISVTHLPPKTNKKGESVNRTKTILGLATAKDGASCEFPPKVEHSGAGPADVQFYISGSEHFETGYHSVYDYFKVRYKIELDMRSPVVNIGTMANPSYLPAEVCIIEPGQSIRSKLSPAQTQKMISFAVRRPKENAEAIVNHGAQIIGATLQPQATDTMGISFTPKLITVPGRVLSNPSVRYKGQGVAAIRSGSWNLNNLTFRVPGAPLKDWAYVMIGDGHIPSDPDRAVTDFINTARAQGLTLSPPLKAGGNTDGLAWVVNYRDPGNVEKNVDEMFRRIKSNANLKNARLLLVILPNDNPTVYKRIKLNGEVFHGIQTVCVIMSKFTKSSNVQYHANVAMKFNLKLGGTNHVLDDSKMGIIAGGKTMVVGIDVTHPAPGSSETAPSVAGMVASIDKTLGQWPAILRLQREAKQEMVDDLTDMLKSRLRLWHKKNGVYPENILVYRDGVSEGQYGKVLHEEHPRLLRACKELYTGGVTAKLPRMTIIVVGKRHNTRFYPTKAEDSEKDNARCGTVVDRGVTETRNWDFFLQAHTALQGTARPAHYYVVLDEIFSRRQNPAYPTVADELEDLTHNMCYLFARATKAVSICPPAYYADLVCERARAYLNYFYDENLSQKSGSASVASAKHLQPHPNVIDTMFYM"
     misc_feature    229..2976
                     /locus_tag="TRV_00123"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    337..780
                     /locus_tag="TRV_00123"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    829..972
                     /locus_tag="TRV_00123"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    976..1371
                     /locus_tag="TRV_00123"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1117..1119,1165..1167,1258..1260,1270..1272,
                     1321..1323,1342..1344,1348..1350)
                     /locus_tag="TRV_00123"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1522..2871
                     /locus_tag="TRV_00123"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1963..1965,1975..1977,2011..2022,2029..2031,
                     2056..2058,2065..2067,2077..2079,2089..2091)
                     /locus_tag="TRV_00123"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(2170..2172,2176..2178,2392..2394,2839..2841)
                     /locus_tag="TRV_00123"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atgtctgaacgcggtggttaccgaggccgcggccgtggtggcggagatcgtggtgaccgtggaggaagtcggggccgcggtggcggtggccgtggtggtcgtggtggtcgcggcggaggagacttcgatggcggacgtggccgtgcaaccttcactggcggcagaggaggacgcggtggaggaggtcgtggacgcggtggttctccaagcatctatggcgaaggccatcctgttcctccaccagatgccgaggttcaaaagatcgaggatacctacatcaaacaacgcaaagggttgagccttgacactctcaagctctcccaggctttccccctgagaccggcctatggtacgcgtggtaaccccgtggttctctgggcaaactacttcccactggtccctcagacaggcatcactctgtaccgctacaccgtcaatgtcggggtcgagggcaagcagccacctggctaccggaaacttaagcggatctttgaaattctgctggaagaccatttgtctgccttccaaggtcacatagccactgattttaaggccaccttgatctcgaccacctccttggatttgacgtctgagtcgctcgaggttgcatatcgggatgaatttgacgccgttgctgagccgaatgcccccagatacccgctccgtatcgttgaaatcgccccgttggtcttggatgagcttctcaagttcctcaagtccccaggagccgatgcattcggccagagcaaggaagaatacctccaggccctcaacatcgtcaccggccacttccccaagatctcccttgatacctttaatgttggccctaacaaacatttcaagacgaaaacgaaggacatttttgatcttggaggaggtctcaatgcttaccggggctattttgtcagcactcgagctgcgacgtctcgtctcctggtcaatgtgcaagtcaagcacacgacttgcttttacgacggacccttggtcaatctgatgacgagcacacacaacttattcggtctgaagcaaatgaacaacttgctcaagggcgtcaaaatctcggtcacccatcttccaccaaagaccaataaaaagggcgagagcgtcaatcgcacaaagactattctcgggcttgctaccgctaaggacggtgcaagctgtgaattcccaccaaaagttgaacactcgggcgctggaccagctgatgtccagttttacatttcaggaagtgagcacttcgaaaccggctaccattctgtttatgactactttaaagtccgttataaaatcgagctggacatgcgttctcctgtggttaatatcggcacgatggccaaccccagctatcttcctgctgaggtctgcataattgagccaggccagtcaatcagatccaagcttagccctgctcagacccaaaagatgatttcttttgccgttagacgtccaaaggaaaatgctgaggccatcgtcaaccacggggcccaaattatcggtgcaaccctccagcctcaagccacagacaccatgggcatctcctttacccccaagctgatcacggttccgggacgcgtcttgagcaacccttctgttcgttataagggtcagggtgtggctgccatccgctctggtagttggaacctcaacaatttaacctttagagttcctggcgctcccttgaaggattgggcgtatgtcatgattggagatggccacatcccttctgatccagatcgcgccgtcacggactttatcaacaccgccagggcacaaggcttaaccttgtcacctccactgaaggctggcggaaacactgatggtctcgcgtgggtggtgaattacagagaccccggcaatgtcgagaagaacgtggatgagatgtttagacgaatcaagtcaaatgccaatctcaagaacgcgagactactgttagttatccttccaaatgataacccgacagtatacaaacggatcaagctcaatggcgaggtcttccatggcattcaaaccgtctgtgtcatcatgtcgaagtttaccaagtcgagcaatgtgcagtaccatgccaacgttgccatgaagttcaatttgaaactcggaggtacaaaccatgtccttgatgattccaaaatgggaatcatcgcaggtggcaagacgatggttgttggcattgatgtcactcaccctgctccaggatcatctgagactgcccctagtgttgctggcatggttgccagtattgacaaaaccctcggccaatggccagcaattctgagattgcagcgtgaggctaagcaagagatggtcgatgatctcactgacatgctcaagtcccgccttcgcctttggcataagaagaatggcgtgtaccctgagaacatccttgtctaccgtgacggtgtctcggagggtcagtacggcaaggtcctgcatgaagagcatccccgcctactcagggcctgcaaggaactttacaccggcggagtaaccgcgaagctgcctcgaatgactatcatcgttgttgggaaacggcacaacactcgtttctacccaaccaaggccgaagattccgagaaggacaatgctcgctgtggcactgttgttgaccgcggtgtcaccgaaactcgtaactgggacttcttcctacaggcccataccgcccttcaaggaactgctcgtcctgcgcattactatgttgtcctcgacgagattttctcccgccgccagaacccggcatatccaaccgtcgctgacgagcttgaagatctcactcacaacatgtgttacctcttcgctcgtgccaccaaggctgtcagcatctgcccaccggcgtactatgccgatcttgtttgcgagagagcaagagcttatctcaactacttttacgacgagaaccttagccagaagtctggatcggcctctgttgcttccgcaaaacatctccagcctcaccccaacgttattgataccatgttctacatgtaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]