GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-26 23:36:44, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XM_002941764            1234 bp    mRNA    linear   VRT 18-DEC-2019
DEFINITION  PREDICTED: Xenopus tropicalis pituitary homeobox 3-like
            [provisional] (homeobox100496651-provisional), mRNA.
ACCESSION   XM_002941764
VERSION     XM_002941764.5
DBLINK      BioProject: PRJNA205740
KEYWORDS    RefSeq.
SOURCE      Xenopus tropicalis (tropical clawed frog)
  ORGANISM  Xenopus tropicalis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae;
            Xenopus; Silurana.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_030683.2) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Dec 18, 2019 this sequence version replaced XM_002941764.4.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Xenopus tropicalis Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1234
                     /organism="Xenopus tropicalis"
                     /mol_type="mRNA"
                     /strain="Nigerian"
                     /db_xref="taxon:8364"
                     /chromosome="7"
                     /sex="female"
                     /tissue_type="liver and blood"
                     /dev_stage="adult"
                     /note="F17 inbred"
     gene            1..1234
                     /gene="homeobox100496651-provisional"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 6 ESTs, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     12 samples with support for all annotated introns"
                     /db_xref="GeneID:100496651"
                     /db_xref="Xenbase:XB-GENE-22065713"
     CDS             58..825
                     /gene="homeobox100496651-provisional"
                     /codon_start=1
                     /product="homeobox protein prophet of Pit-1"
                     /protein_id="XP_002941810.1"
                     /db_xref="GeneID:100496651"
                     /db_xref="Xenbase:XB-GENE-22065713"
                     /translation="
MDVGREKIQDNDTQERGSFNRLHGKTRRRRTVYSQTHLDLLLSTFNKDPYPGITVRERLSQITGIHESRIQVWFQNRRARKNKKSVQERENVHSTNEWHQCNTIFKTNTTSQAEWISKNNGHYEKQEFGFGDYSDTSYAYTCSSKPNALGLPLPLQWSKPVPAPLNHLSSVYPPILSDSRTQQCQVFIQHISRPSASFLHSKDYVQKSVFVSPAESVSYGMMQEWSLEQMLEEFQPCWTEVADDLIGDKNCHSVQ"
     misc_feature    136..312
                     /gene="homeobox100496651-provisional"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(136..150,154..156,205..207,223..225,262..264,
                     268..273,280..285,289..297,301..306)
                     /gene="homeobox100496651-provisional"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(142..144,151..153,271..273,280..285,292..294)
                     /gene="homeobox100496651-provisional"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
ORIGIN      
actgaaaggttaccattgaagagcatttacacagaaagcttggcgaagaagctggagatggatgtgggcagagagaaaatccaagacaatgatacccaagaaagaggtagtttcaaccgcctccatggaaagacaagaaggagaaggactgtatacagccaaacccaccttgacctcttgcttagcacatttaataaagacccatatcctggaatcacagtaagagaaagactgtcacaaataactggcatacatgaatcccgaatccaggtctggttccaaaacaggagagccaggaagaacaagaaaagtgtacaggaaagagaaaatgtacatagcacaaatgaatggcatcaatgcaatactatttttaaaaccaacacaacatcccaggctgagtggatttctaagaacaatggacattatgaaaagcaggaatttggctttggagattactctgatacctcatacgcttacacctgctcctccaaacccaatgcacttggtttgcctcttccacttcagtggtcaaaacctgtgccggcaccattgaaccatctgtcctcagtatatccaccaatattatctgatagcagaacacagcaatgtcaagtatttatccagcacatatctagaccttctgccagctttctgcattcaaaagattatgtacaaaagtcagtgtttgtcagtccagcagagtctgtttcttatggcatgatgcaagaatggtccttggaacagatgttggaagaatttcagccttgctggacagaggtggcagatgatttaattggtgataaaaactgtcattcagtgcaataaagaagagagtacttacaatttttcacctagagcttattctaataatgtatgttaggtaaaagtaacattagtgcaaataagtgaaaaggtttgtacaggtctagtcacccgaatcaaccagtgggtagcattggttacctgtttaaaagcaaatatcttactggttgctaagggttaatgcacctgtgtagacattgtggcttttattacatatgggggtaggtatgtgtctaatctcttattcatattgaaagatattattgatagcaccaaaactttgcagtctatagtgcaagaacattatctaacaataactggtgtcacagtttagaaaaggctgtggtattacccatatagtgatactgcagaatatattgaagttttataaataaagatatttttacattca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]