2024-04-26 10:24:39, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_002906034 2784 bp mRNA linear PLN 22-JUL-2010 DEFINITION Phytophthora infestans T30-4 Argonaute1 (AGO1) (PITG_04470) mRNA, complete cds. ACCESSION XM_002906034 VERSION XM_002906034.1 KEYWORDS RefSeq. SOURCE Phytophthora infestans T30-4 ORGANISM Phytophthora infestans T30-4 Eukaryota; Sar; Stramenopiles; Oomycota; Peronosporales; Peronosporaceae; Phytophthora. REFERENCE 1 (bases 1 to 2784) AUTHORS Nusbaum,C., Haas,B., Kamoun,S., Fry,W., Judelson,H., Ristaino,J., Govers,F., Whisson,S., Birch,P., Birren,B., Lander,E., Galagan,J., Zody,M., Devon,K., O'Neil,K., Zembek,L., Anderson,S., Jaffe,D., Butler,J., Alvarez,P., Gnerre,S., Grabherr,M., Mauceli,E., Brockman,W., Young,S., LaButti,K., Sykes,S., DeCaprio,D., Crawford,M., Koehrsen,M., Engels,R., Montgomery,P., Pearson,M., Howarth,C., Larson,L., White,J., O'Leary,S., Kodira,C., Zeng,Q., Yandava,C. and Alvarado,L. CONSRTM The Broad Institute Genome Sequencing Platform TITLE Annotation of Phytophthora infestans T30-4 JOURNAL Unpublished REFERENCE 2 (bases 1 to 2784) AUTHORS Nusbaum,C., Kamoun,S., Fry,W., Judelson,H., Ristaino,J., Govers,F., Whisson,S., Birch,P., Birren,B., Lander,E., Galagan,J., Zody,M., Devon,K., O'Neil,K., Zembek,L., Anderson,S., Jaffe,D., Butler,J., Alvarez,P., Gnerre,S., Grabherr,M., Mauceli,E., Brockman,W., Young,S., LaButti,K., Sykes,S., DeCaprio,D., Crawford,M., Koehrsen,M., Engels,R., Montgomery,P., Pearson,M., Howarth,C., Larson,L., White,J., O'Leary,S., Kodira,C., Zeng,Q., Yandava,C. and Alvarado,L. CONSRTM The Broad Institute Genome Sequencing Platform TITLE Direct Submission JOURNAL Submitted (23-OCT-2006) Broad Institute of MIT and Harvard, 7 Cambridge Center, Cambridge, MA 02142, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_003303754). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..2784 /organism="Phytophthora infestans T30-4" /mol_type="mRNA" /strain="T30-4" /db_xref="taxon:403677" gene <1..>2784 /locus_tag="PITG_04470" /db_xref="GeneID:9464323" CDS 1..2784 /locus_tag="PITG_04470" /codon_start=1 /product="Argonaute1 (AGO1)" /protein_id="XP_002906080.1" /db_xref="GeneID:9464323" /translation="
MPGRRNKQQDSEPVIGRPRRGRGQASSRGRGRSGPATATAAPVPPPATRAVAPPPAPAPAAPSVSSLALELEEKARIPDEPRLVQPLVRTHFPPRPGFGKAGKPVKLHANHFKVNFKLAGDVFHYDVMMSEGGRSFGNDGPPKTLANKIMAALLSELKRQFPAFMVVSDARKNIYAPRRLPFQLQEFGSLTLPEDGGRAREFSATVKEADPVAIRMQQLDELFAGRLNYTPHDALQALDVALRHSASQRFTVVGRNLFNGNGAKSLGEGAELWFGYFQSLRATQNRLVVNLDLAATAFVEEMDVLDFLCESLSLRNLPAALNNPQHSAFSKAIRGVKVNITHRPGVRRSYRVNGLTKTSAQDTYFENDEGQRLNIVQYFQKTYNLRLRYPKLPCLHVGAPQKKNYLPMEVCHIMAGQKCPRKVTDNQVANMIKFTCTPPDQRKRSIEQKFREAGFNTDPTLRAFGLEVEPRMVETTGRQLPPPTIEYSGGARENPRDGAWNMRGKKFNTPAQLKSWAVISMADPRYCDQTSIEKFFKAVMAQMGQLGMRCPPKLPPILLKQRREDSVRGMFQAGVKAASQTFKTPPQIIWMINPRMDAHAYGELKLMSDSEAGVGILSQCMLSKHIPKCNPQYIANILMKVNTKLGGRNGVISGQLPLVSASRTIIFGADVTHPSPMDRSRPSIAAVTASMDANFIRHASAIRAQGHRVEQIMNLKDMVVELLKQFYRQTRGKPDRIVFYRDGVSEGQFHMVLNFEVTAIREACRTLEVGYLPPITFVIVQKRHNTRLFPDNPKDADRSGNVKAGTVVDTGICHPIENDFYLMSHAGLQGTSRPTHYHVLLNEIGFTADELQTLTYKLCYTFARCTRSVSMVPSAYYSHLVAFRARFFLAEGSDTASTVSGFSETAPETDTRMYDLHQAMKSEMYFV"
misc_feature 499..726 /locus_tag="PITG_04470" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 757..900 /locus_tag="PITG_04470" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 901..1239 /locus_tag="PITG_04470" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(1048..1050,1093..1095,1123..1125,1135..1137, 1189..1191,1210..1212,1216..1218) /locus_tag="PITG_04470" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1375..2667 /locus_tag="PITG_04470" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1801..1803,1813..1815,1855..1866,1873..1875, 1897..1899,1906..1908,1918..1920,1930..1932) /locus_tag="PITG_04470" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(2008..2010,2014..2016,2224..2226,2635..2637) /locus_tag="PITG_04470" /note="active site" /db_xref="CDD:240015" ORIGIN
atgccggggcggcgaaacaagcagcaagactccgagcccgttattggtcgaccccgtcgaggccgtgggcaggccagcagcaggggccgtggacgtagtggccctgctactgctactgccgcacctgttcctccgccagccacacgtgccgttgcaccccctcctgcgcctgcgcctgcagctcccagcgtctcgtcgctcgctttggagctcgaggagaaagcgcgtatccctgatgagccgcgtctagtgcagccactcgtgcgcacccacttccctccccgtccgggcttcggcaaggctggcaaacctgtgaagctgcatgctaaccacttcaaggtcaacttcaagttagcaggcgacgtgtttcactacgacgtcatgatgtccgagggcggccggagctttggtaacgatggaccacccaagacgctggccaacaagatcatggcagcgctcttgtctgagcttaagcgccaatttccggcgtttatggtggtatccgacgcgcgtaagaatatttacgccccgcgtcgactaccgttccaactccaagagtttggctcactcacgctacctgaagacggaggcagagccagagagttctccgccactgtgaaagaagccgacccagtggctatccgcatgcagcaattggacgagctcttcgccgggcgcttgaattacacgccgcatgacgcactgcaagcgctcgacgtggctctgcgccattctgcatcgcagagattcactgtggtcggacggaatctattcaatggcaacggagccaaatccctcggagaaggagccgagctctggttcggctacttccagagcttgcgagccacgcaaaaccgccttgtagtcaacttggacttggcagccactgccttcgtagaggagatggacgtgctagacttcctctgcgagtcgctatccttgaggaacctcccagctgctctgaataacccccaacactcggccttcagtaaggccatccgtggcgttaaggtgaacatcactcatcgtccaggagtgagacgcagctaccgtgttaacggtctgaccaagacaagcgcacaagacacgtacttcgagaacgacgaggggcaacgtcttaacatcgtgcaatatttccaaaagacgtacaacctgcgtctccgctacccaaagctgccgtgtttgcatgttggagcccctcagaagaagaattatcttcctatggaggtgtgtcacattatggcgggacagaaatgtcctcgcaaggtcacggacaaccaagtggccaatatgataaagtttacgtgcacgccgcccgaccaacgcaagcgatcgatcgagcagaagttccgtgaagctggcttcaatacggacccgaccctgagagcctttgggctggaagtggagccacggatggttgagacgacgggccgccagttgccaccgcctacgattgagtacagcggaggagctcgtgagaatcctcgtgacggagcgtggaacatgcgcggcaagaagttcaacacgccagcgcagctcaagtcgtgggcggttatcagtatggccgacccgagatactgcgaccaaacgagtatcgagaagttttttaaggcggtgatggcgcagatgggtcagttgggcatgcgatgtccgcctaaactgcctccgatcctgctgaagcagcgccgggaggattcagtgcgtggaatgttccaagcgggagtgaaggcggccagtcagacgttcaagacgccgccgcagatcatctggatgatcaatccgcgtatggatgcacacgcttatggagagttaaagctgatgtcggacagtgaggcaggggtgggtattctgtcgcagtgtatgctgtcgaagcatatcccgaagtgcaacccgcagtacatcgccaacatcctgatgaaggtgaacaccaagctgggcggcaggaacggtgtgatcagtggacagctgccgctggtgtcggcgtcgcgcaccataatctttggagctgatgtaacgcatcctagtccaatggacaggagtcgaccgtctatcgctgctgtgacagcctctatggacgccaacttcatccgccacgcgtcggcgatccgtgcgcagggccaccgtgtggagcagattatgaatctaaaggatatggtggtggagctgttgaagcagttctacaggcagacccgtggcaaaccagatcgtattgtcttctaccgcgatggagtgagcgaaggacagttccacatggtgttaaactttgaagtcacggctattcgtgaggcctgccggacgctggaggtcggctacttgcctccgatcacgtttgtgatagtccagaagcgtcacaatactcgtctgttccccgacaacccgaaagatgcggatcgcagtggcaacgtgaaggctggaactgttgtggacacgggtatctgtcatccgatcgaaaacgatttctatctgatgagtcacgctgggctacaaggcactagccgtcccacgcactatcatgtgctgctgaatgaaatcggctttacggcggatgaactgcagacgcttacgtacaaactgtgctatacgttcgcacgctgcactcgttctgtctccatggtcccgtcggcctactattcgcatctcgtggcattccgtgcgcgattcttcctggcggagggtagtgacactgcctcaacggtctctggcttcagtgaaactgcgccagaaacagatacgcgcatgtatgacttgcaccaagccatgaagagcgagatgtacttcgtgtaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]