GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:09:46, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_002153707            3892 bp    mRNA    linear   PLN 29-NOV-2019
DEFINITION  Talaromyces marneffei ATCC 18224 RNA interference and gene
            silencing protein (Qde2), putative (PMAA_102710), partial mRNA.
ACCESSION   XM_002153707
VERSION     XM_002153707.1
DBLINK      BioProject: PRJNA32665
            BioSample: SAMN02953685
KEYWORDS    RefSeq.
SOURCE      Talaromyces marneffei ATCC 18224 (Penicillium marneffei ATCC 18224)
  ORGANISM  Talaromyces marneffei ATCC 18224
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Eurotiomycetes; Eurotiomycetidae; Eurotiales; Trichocomaceae;
            Talaromyces.
REFERENCE   1  (bases 1 to 3892)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (27-NOV-2019) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   2  (bases 1 to 3892)
  AUTHORS   Fedorova,N.D., Joardar,V., Maiti,R., Schobel,S., Amedeo,P.,
            Galens,K., Inman,J.M., White,O.R., Whitty,B.R., Wortman,J.R. and
            Nierman,W.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-OCT-2007) J. Craig Ventor Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_002196670).
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..3892
                     /organism="Talaromyces marneffei ATCC 18224"
                     /mol_type="mRNA"
                     /strain="ATCC 18224"
                     /culture_collection="ATCC:18224"
                     /type_material="culture from holotype of Talaromyces
                     marneffei"
                     /db_xref="taxon:441960"
                     /chromosome="Unknown"
     gene            <1..3892
                     /locus_tag="PMAA_102710"
                     /db_xref="GeneID:7031104"
     CDS             1..3039
                     /locus_tag="PMAA_102710"
                     /note="encoded by transcript PMAA_102710A"
                     /codon_start=1
                     /product="RNA interference and gene silencing protein
                     (Qde2), putative"
                     /protein_id="XP_002153743.1"
                     /db_xref="GeneID:7031104"
                     /translation="
MSSGYRRGGDRGGQTGFRGDRGGRGRGGRSDQGGGQRGRGGSGGFQGFRGTEQVIQVFSNPQGQDPKVATVEDALHPATKKTLDLSSLRVTEGFPIRPGYGTRGTKVELTANYVELLPPSDLILHRYDIQISPEVAGRKRSRVVQLLLRSAEVASHRDEIATDFRSTLISKTKFPRDETIIEIRYASEGEDEPMARATTYRVRVLYTKTLCILELINYINSTNLDQSFGDKQELTQALNIFLNHFAKSAGNLVSIRSKTFSLNQNAVRGDLGSGLEVIRGFFSSVRMATCRILVNINVSHGAFYQSGPLLALMNSFGVRNTAALEKFLKLLRIRTTHLPEKRNRANEVIPRVKTISGLARKDDGHHMAHPPRVRQHGAGAKDVEFWIDGEASSSSTASVDTKSGTKGKGKGKGKARLERSAISGSGKYISVFDFFKTTYGRILQHPELPLLNCGSRENPMYLPVEVCIVLPGQPSKSKLDGTQTQQMIRHAVRKPWENAAAIVAEGVQTVGLDENSNALMRSFGLRIAQGLIKIPGRVLVGPKVIYKGNKTANPRFGSWNMIDIKFNTGASLARWSYLMISLSGLRDSFNQESLGAVMTEFYEALKRMGVVASPPLAGQRLLLQHPDDHAISSILQRAAGALDLLYVILPQANTTLYKRIKTLTDKDFGIHTICSVASKLAKERGRDQYMANIALKFNLKLGGINQIVENRNLGIVDQNKTMVVGIDVTHPSPGSSSNAPSISAMVASIDRSLGQWPATLRIQRARQENVDDLTEMFKSRLTLWKTRGKHTALPENILIYRDGVSEGQYDMVLSRELPQLRRACEEVYPTADTKLGLPRFTIIICGKRHKTRFYPTTEEDCDRSGNTKPGTVVDRGVTEARNWDFFLQAHAALQGTARPCHYYIVHDEIFRQVYAKSIPAPFQNIADIVEDLTHNMCYLFGRATKAVSLCPPAYYADLACERARCYLASLFDTPSPSAAPSVTGSSAAEGGWQPGANDVQIHPKLKDTMFYI"
     misc_feature    289..3033
                     /locus_tag="PMAA_102710"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    289..726
                     /locus_tag="PMAA_102710"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    766..915
                     /locus_tag="PMAA_102710"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    <1267..1410
                     /locus_tag="PMAA_102710"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    1558..2901
                     /locus_tag="PMAA_102710"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1969..1971,1981..1983,2017..2028,2035..2037,
                     2065..2067,2074..2076,2086..2088,2098..2100)
                     /locus_tag="PMAA_102710"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(2179..2181,2185..2187,2404..2406,2869..2871)
                     /locus_tag="PMAA_102710"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atgtccagcgggtatagacgtggcggtgatagaggaggacagaccggcttccgtggtgatcgcggaggcagaggaagagggggaaggtccgaccagggaggaggccagagaggccggggagggagcggtggttttcaaggctttagagggactgagcaagtcatccaggtcttttccaatccacaaggccaagatccgaaagtcgccacagtcgaagatgccttgcatccagcgacaaagaagacactcgatcttagcagcttgagggtgactgaaggcttccccatccgtccgggatacgggaccagaggcaccaaagttgaactcacggcaaattacgtcgaattgttgccaccatcagatttgattctacaccgatacgatatccagatcagcccagaggtcgcaggaaggaaacgttcccgggtcgtacagctcttgctgcggtcggcggaagtggcatcgcaccgggacgagattgcgactgactttcgatctacccttatatccaaaaccaagtttccgcgtgatgagaccatcatcgagatccgctacgcttctgaaggtgaagacgagccgatggctagagccaccacatatagagtccgtgtcctctatacgaagaccttatgtattctcgagttgatcaactatataaactctacgaatctggaccagtctttcggagacaagcaggaattgacgcaagctctgaatatctttctaaatcacttcgccaaatctgcaggaaatcttgttagtattagatcaaagaccttttctctgaaccaaaatgcagtaagaggagacttaggttccggcttagaagtcattcggggcttcttttcaagcgtgcgcatggcgacttgtcgcatcctggtcaacattaatgtcagccacggagctttctatcagtctggccctttactggcgctcatgaacagcttcggtgtccgcaacacagccgccttggaaaagtttctcaaactacttcgtatccgaaccacgcatctgcctgaaaagcgcaacagagccaacgaggtaattcccagagtcaagactatctctggacttgccaggaaggacgacggacatcacatggctcacccacctcgcgttagacagcatggagcaggcgctaaagatgttgagttttggattgacggtgaagccagctcttctagtacagcctcggtagacaccaagagcgggacgaaaggcaagggtaagggcaagggcaaggctcggctagagagatcggcaatatccggctctggaaagtacatcagtgtgtttgacttcttcaaaacaacatatggtcggatcctgcaacaccccgagctcccgttgctcaactgcggcagtcgggaaaatccaatgtatcttccagtagaagtctgcattgtcctccctggtcagccatcgaagtcgaagctcgacggcacccaaacccagcagatgattcgccacgctgttcggaagccttgggagaatgcggccgcaattgtcgcggagggggtgcaaactgttggtctcgacgagaattccaatgcactcatgcgctcttttggccttagaatcgcacaaggcctcatcaaaatccccggtcgcgtccttgtcggcccaaaggttatctacaagggcaataagaccgccaatccacgcttcggtagctggaatatgatcgatatcaaattcaacaccggcgcctcacttgccaggtggtcctacctgatgatttcgctttccggcttacgtgattcattcaaccaggaaagcctaggggccgtaatgacagagttctatgaagccttgaaaagaatgggtgtcgtcgcttctccaccactcgcaggtcaacgcctcctacttcaacatccagatgatcatgcgatcagctcaattctgcagcgtgccgcaggagctttagatctgctttatgtcattctgccccaggccaacacgacactatataagcgcattaagacgctcacagacaaggattttggcatccacactatctgctctgtggcttccaaacttgcgaaagagcgtggtcgcgaccaatatatggccaatatcgctctgaagttcaatcttaagctgggcggtatcaatcagatcgtggagaacaggaatctcggcatcgtcgaccagaacaagaccatggttgtcggcatcgatgtgacacatccttcgcctggctcctcctccaacgcaccttcgatctctgcaatggtggcttctattgacagatctctagggcaatggcccgcgacattgcgcatccaacgcgcgaggcaggagaatgtcgacgacctcacagagatgtttaagtctcgcctgaccctatggaagaccagaggcaaacataccgcccttcctgagaacattctcatttaccgcgatggagtctctgaaggtcagtacgatatggtgctctcgcgagagcttcctcaactccgccgcgcctgcgaagaggtgtacccaacagccgacaccaaattaggccttccacgattcactatcataatctgcggcaagcggcataaaacccgattctaccccaccaccgaggaagactgcgacaggtctggtaataccaagcctggcactgtcgtcgaccgcggggtgaccgaagcacggaactgggattttttcctgcaggcacatgccgcacttcaggggactgcacggccatgtcattactacatcgtgcatgatgagattttccggcaggtctatgcgaagtcgattccggctccatttcagaacattgccgatatcgtagaagatctcacacataatatgtgctacttgttcggccgcgcaaccaaggctgtaagtctatgtcctccagcatactacgctgatctcgcgtgtgagcgcgcgagatgctatctggcaagtttgttcgacacgccgtccccgagtgcggccccgtccgtgactggatcatcggcggctgaaggaggttggcagcctggcgccaatgacgtgcagatccatccgaagctgaaagacacgatgttctatatctaaaataaatgacgagaagtggtggtaaagagccagatggagtttgaaatacagtcttaccgcatgcttgctgttccttcacgatcttatcctttggttcgtggggtgcgccttaaatttttttttcccctgggacttttagcatacgctagcctaattcaggttaaggctgggaggctacttgcgactgaaggaaccaaaatagtggcctgacagccatatgcatgaacactggtgtgcgtagacaccagctagacctgtatgtttctagaaagggaacagtgccttcacatctgcgagcattggcactagtcaggagcatccaccagtcttgtgctcttactgcatggtgtccctgcaaatctccattgcttctgcacaggttttgtgtccgagcacatttgtgcctccacacagtagtgtgattgcatccaagtgtgttcgcataattacgcattcacattatagtgctattgcatttaatggtatcagcacccacgtactctcgcaacttgatggctttccactgcccgtgtgcctttccactgccctcgtgtctttacacctaggtgtatatacaaataattcgtgtctttgcactagttgtgagtccctacactctgtggctcctacactacaaggcgtctgcactatttgacaggctttgctctgtagagtctagccacacccgtgattcaatacttctcataaaatttatggttgcccctacttttcagtgcctttgcttcttcgtgtcgtgacacaaccaagaccaatcagccccaggcatcgcttgattagacagtctatcaacgcaagcttggtttgttgagactacagtatatgcgaaaagtta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]