LOCUS       NR_189662               2616 bp    RNA     linear   ROD 28-AUG-2024
DEFINITION  Mus musculus solute carrier family 35 (UDP-galactose transporter),
            member A2 (Slc35a2), transcript variant 9, non-coding RNA.
ACCESSION   NR_189662
VERSION     NR_189662.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 2616)
  AUTHORS   Elziny,S., Sran,S., Yoon,H., Corrigan,R.R., Page,J., Ringland,A.,
            Lanier,A., Lapidus,S., Foreman,J., Heinzen,E.L., Iffland,P.,
            Crino,P.B. and Bedrosian,T.A.
  TITLE     Loss of Slc35a2 alters development of the mouse cerebral cortex
  JOURNAL   Neurosci Lett 836, 137881 (2024)
   PUBMED   38909838
  REMARK    GeneRIF: Loss of Slc35a2 alters development of the mouse cerebral
            cortex.
REFERENCE   2  (bases 1 to 2616)
  AUTHORS   Cheng,H., Wang,S., Gao,D., Yu,K., Chen,H., Huang,Y., Li,M.,
            Zhang,J. and Guo,K.
  TITLE     Nucleotide sugar transporter SLC35A2 is involved in promoting
            hepatocellular carcinoma metastasis by regulating cellular
            glycosylation
  JOURNAL   Cell Oncol (Dordr) 46 (2), 283-297 (2023)
   PUBMED   36454514
  REMARK    GeneRIF: Nucleotide sugar transporter SLC35A2 is involved in
            promoting hepatocellular carcinoma metastasis by regulating
            cellular glycosylation.
REFERENCE   3  (bases 1 to 2616)
  AUTHORS   Hayashi,Y., Ito,Y., Yanagiba,Y., Kamijima,M., Naito,H. and
            Nakajima,T.
  TITLE     Differences in metabolite burden of di(2-ethylhexyl)phthalate in
            pregnant and postpartum dams and their offspring in relation to
            drug-metabolizing enzymes in mice
  JOURNAL   Arch Toxicol 86 (4), 563-569 (2012)
   PUBMED   22159897
  REMARK    GeneRIF: DEHP exposure did not influence lipase activity, whereas
            it slightly enhanced UGT activity and exclusively increased CYP4A14
            levels in pregnant and/or postpartum dams.
REFERENCE   4  (bases 1 to 2616)
  AUTHORS   Oelmann,S., Stanley,P. and Gerardy-Schahn,R.
  TITLE     Point mutations identified in Lec8 Chinese hamster ovary
            glycosylation mutants that inactivate both the UDP-galactose and
            CMP-sialic acid transporters
  JOURNAL   J Biol Chem 276 (28), 26291-26300 (2001)
   PUBMED   11319223
REFERENCE   5  (bases 1 to 2616)
  AUTHORS   Means,G.D., Toy,D.Y., Baum,P.R. and Derry,J.M.
  TITLE     A transcript map of a 2-Mb BAC contig in the proximal portion of
            the mouse X chromosome and regional mapping of the scurfy mutation
  JOURNAL   Genomics 65 (3), 213-223 (2000)
   PUBMED   10857745
REFERENCE   6  (bases 1 to 2616)
  AUTHORS   Ishida,N., Yoshioka,S., Iida,M., Sudo,K., Miura,N., Aoki,K. and
            Kawakita,M.
  TITLE     Indispensability of transmembrane domains of Golgi UDP-galactose
            transporter as revealed by analysis of genetic defects in
            UDP-galactose transporter-deficient murine had-1 mutant cell lines
            and construction of deletion mutants
  JOURNAL   J Biochem 126 (6), 1107-1117 (1999)
   PUBMED   10578063
REFERENCE   7  (bases 1 to 2616)
  AUTHORS   Ishida,N., Miura,N., Yoshioka,S. and Kawakita,M.
  TITLE     Molecular cloning and characterization of a novel isoform of the
            human UDP-galactose transporter, and of related complementary DNAs
            belonging to the nucleotide-sugar transporter gene family
  JOURNAL   J Biochem 120 (6), 1074-1078 (1996)
   PUBMED   9010752
REFERENCE   8  (bases 1 to 2616)
  AUTHORS   Lennon,G., Auffray,C., Polymeropoulos,M. and Soares,M.B.
  TITLE     The I.M.A.G.E. Consortium: an integrated molecular analysis of
            genomes and their expression
  JOURNAL   Genomics 33 (1), 151-152 (1996)
   PUBMED   8617505
REFERENCE   9  (bases 1 to 2616)
  AUTHORS   Hara,T., Yamauchi,M., Takahashi,E., Hoshino,M., Aoki,K., Ayusawa,D.
            and Kawakita,M.
  TITLE     The UDP-galactose translocator gene is mapped to band
            Xp11.23-p11.22 containing the Wiskott-Aldrich syndrome locus
  JOURNAL   Somat Cell Mol Genet 19 (6), 571-575 (1993)
   PUBMED   8128316
REFERENCE   10 (bases 1 to 2616)
  AUTHORS   Hara,T., Hattori,S. and Kawakita,M.
  TITLE     Isolation and characterization of mouse FM3A cell mutants which are
            devoid of Newcastle disease virus receptors
  JOURNAL   J Virol 63 (1), 182-188 (1989)
   PUBMED   2535724
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL671978.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR17784644.139690.1,
                                           SRR17253014.4729283.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849377
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-101               AL671978.2         40630-40730
            102-576             AL671978.2         42046-42520
            577-728             AL671978.2         45909-46060
            729-2616            AL671978.2         48437-50324
FEATURES             Location/Qualifiers
     source          1..2616
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="X"
                     /map="X 3.56 cM"
     gene            1..2616
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /note="solute carrier family 35 (UDP-galactose
                     transporter), member A2"
                     /db_xref="GeneID:22232"
                     /db_xref="MGI:MGI:1345297"
     misc_RNA        1..2616
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /product="solute carrier family 35 (UDP-galactose
                     transporter), member A2, transcript variant 9"
                     /db_xref="GeneID:22232"
                     /db_xref="MGI:MGI:1345297"
     exon            1..101
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    11..337
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /inference="COORDINATES:
                     alignment:Blast2seq::RefSeq|NM_001083937.2"
                     /note="primary ORF has stop codon >50 nucleotides from the
                     terminal splice site; nonsense-mediated decay (NMD)
                     candidate"
     exon            102..576
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /inference="alignment:Splign:2.1.0"
     exon            577..728
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /inference="alignment:Splign:2.1.0"
     exon            729..2616
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

agatgccaacatggcagcggttggggttggtggatctaccgctgcggccggggctggggctgtgtcctcgggcgcgttggaacctgggtccactacagcggctcaccggcgcctcaagtatatatccttagctgtgctggtggtccagaatgcctccctcatcctcagcatccgctacgctcgcacactgcctggggaccgcttctttgccaccactgctgtggtcatggctgaagtgctcaaaggtctcacctgtctcctgctgctcttcgcacaaaagaggggtatgagtcaccaatggggttggttggtgggactccctaagttaagggtgtaagtacccctgggaggtttgctgggagagtagactggtgtgtctgaggatgcttgaggagtaggtaggagcttttaagcttcctgaccactgcagctatgtgaagttgcatctccacgtggatattccttatacctgagaactacaccagtgagattgactgcccacaggcaacagaagacccacggtgattgaaaggtagaggcatgaagatcaggagctcaagataacataagttcaaggtaatgtgaagcacctggtcctcttcctccatgaggctgtcctggtccaatatgtggacacactcaagcttgcggtgccctctctcatctataccttgcagaataacctccagtatgttgccatcagcaacctgccagctgccactttccaggtgacatatcagctgaagatcctgactacagcgctcttctctgtgctcatgttgaatcgcagcctctcacgcctgcagtgggcctctctgctgctgctcttcactggtgtcgccattgtccaggcacagcaagctggtgggagtggcccacggccactggatcagaacccgggggcgggcttagcggcagttgtggcctcctgtctctcctcaggcttcgctggggtctactttgagaagatcctcaaaggcagctcaggttctgtgtggcttcgtaacctacagctcggcctctttggcacagcgctgggcctggtggggctctggtgggctgagggcaccgccgtggccagtcaaggcttcttctttgggtacacacctgctgtctggggtgtagtactaaaccaagcctttggtgggcttctggtggctgttgttgtcaagtatgctgacaacatcctcaagggctttgccacctccctgtctattgtgctgtccactgttgcctccattcgcctctttggcttccacctggacccattatttgccctgggcgctgggctcgtcattggtgctgtctacctctacagccttccccgaggtgcagtcaaagccatagcctcggcctcggcctctgggccctgcattcaccagcagcctcctgggcagccaccaccaccgcagctgtcttctcgaggagacctcaccacggagccctttctgccaaagtcagtgctggtcaagtgagagctggtggtggttgggggaacagggcagggggttgggttggagggggttgggcttctgcaggtccaaaaagttgttgccagggcctggcttttgtgggttggaggtttattttctcccataattctagagggatatggaactagggctgaatgtcacatgaacgcttcctgatagatggactctcctctcctggaggagctttttagagctgcttcctctgccttgggctaacctctttgggaacagggttggggtactgctattccaggcctttcccccatgaccctgtgctggagatgtcctgtctcgcatgcctgggacagtccctcccagccatcctgcagactggataaaagccctgcagctctccaataacgactaatgactcctcgtggggttcatttcctattgtatgaggtcttctctcctgcaccatcaccctggatcatgacaacagcgtggtctctgctgtggctttggggcagtttccccggtacagagacccttgaagagcaatcagcctgttgtaagtgcccggaacgaggagagaggcacaagctgaggatttcgcatcagctcatcttggggagggtgcaataagtgccatttgctttccaatagtttgggatggagatttgtttgtgctatcattagatcaatgatccagcgtgttgggaaaatggggaggggaggtccttgaagtggctgaatctcatgtaattgacgagacagaggcgaaggattctcttcagaaacatccagacaaaaactaaagctgccgatccgcctgcagctccattggcgtttaaaacatcctttcaggatgggtgtcagaattgatgaaacatggaacctgcgcccctgcactccccaaagcttattaactccttaactgtatcccagatgtgtgtgtgtgtgtgtgttcgcgcgcgcgtggggatgtgtgtggatgtgtgcacgcacacttaagtgcatgcatggaaggtgcctgggctgtctttgctatatgtaaatagggccactggatctttatttttgattaatttgttctgattttttttttggtttgttttttaaggaactgtaatgaacaaatgtcaggatacccaatgccaaataaagatgatgtatttattta

//