GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-06-02 01:33:25, GGRNA.v2 : RefSeq release 200 (May, 2020)

LOCUS       NR_165261               3932 bp    RNA     linear   ROD 08-JAN-2020
DEFINITION  Mus musculus nrde-2 necessary for RNA interference, domain
            containing (Nrde2), transcript variant 5, non-coding RNA.
ACCESSION   NR_165261 XR_001780446
VERSION     NR_165261.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 3932)
  AUTHORS   Sharov AA, Piao Y, Matoba R, Dudekula DB, Qian Y, VanBuren V, Falco
            G, Martin PR, Stagg CA, Bassey UC, Wang Y, Carter MG, Hamatani T,
            Aiba K, Akutsu H, Sharova L, Tanaka TS, Kimber WL, Yoshikawa T,
            Jaradat SA, Pantano S, Nagaraja R, Boheler KR, Taub D, Hodes RJ,
            Longo DL, Schlessinger D, Keller J, Klotz E, Kelsoe G, Umezawa A,
            Vescovi AL, Rossant J, Kunath T, Hogan BL, Curci A, D'Urso M, Kelso
            J, Hide W and Ko MS.
  TITLE     Transcriptome analysis of mouse stem cells and early embryos
  JOURNAL   PLoS Biol. 1 (3), E74 (2003)
   PUBMED   14691545
REFERENCE   2  (bases 1 to 3932)
  AUTHORS   Piao Y, Ko NT, Lim MK and Ko MS.
  TITLE     Construction of long-transcript enriched cDNA libraries from
            submicrogram amounts of total RNAs by a universal PCR amplification
            method
  JOURNAL   Genome Res. 11 (9), 1553-1558 (2001)
   PUBMED   11544199
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC166349.4.
            On Jan 8, 2020 this sequence version replaced XR_001780446.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1660813.260071.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN01164139 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-110               AC166349.4         130627-130736       c
            111-234             AC166349.4         122298-122421       c
            235-468             AC166349.4         120904-121137       c
            469-627             AC166349.4         116957-117115       c
            628-1078            AC166349.4         114826-115276       c
            1079-1484           AC166349.4         112980-113385       c
            1485-1618           AC166349.4         111092-111225       c
            1619-1739           AC166349.4         108745-108865       c
            1740-1915           AC166349.4         105444-105619       c
            1916-2302           AC166349.4         103238-103624       c
            2303-3228           AC166349.4         101445-102370       c
            3229-3578           AC166349.4         100382-100731       c
            3579-3650           AC166349.4         97288-97359         c
            3651-3932           AC166349.4         96537-96818         c
FEATURES             Location/Qualifiers
     source          1..3932
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="12"
                     /map="12"
     gene            1..3932
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /note="nrde-2 necessary for RNA interference, domain
                     containing"
                     /db_xref="GeneID:217827"
                     /db_xref="MGI:MGI:2670969"
     misc_RNA        1..3932
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /product="nrde-2 necessary for RNA interference, domain
                     containing, transcript variant 5"
                     /db_xref="GeneID:217827"
                     /db_xref="MGI:MGI:2670969"
     exon            1..110
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    47..3313
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="COORDINATES:
                     alignment:Blast2seq::RefSeq|NM_001290303.1"
                     /note="primary ORF has stop codon >50 nucleotides from the
                     terminal splice site; nonsense-mediated decay (NMD)
                     candidate"
     exon            111..234
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            235..468
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            469..627
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            628..1078
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            1079..1484
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            1485..1618
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            1619..1739
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            1740..1915
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            1916..2302
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            2303..3228
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            3229..3578
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            3579..3650
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            3651..3932
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
agacggcgccatttctgaggcaggagtggtagtgcggcctgtgatcatggcgctgttcccggcttttgcggacgtaagtgaggcctccggtgatggggcattcaggaaagagttagattggctgagcaacccaagctttcgtgttggaaatctaacttctctgagccgacaaactgaagaggtcacagcccttgcttctgaagggtcaccaccgccaaggtactcttttatcaggagtcctctgaagtcagagctctcaggtgagagcaacactagcgagaagctcgcacagacaagcaggaagaagaagaaggagaaaaagaagagacggaagcatcagcaccacaggaaaaccaagaggaggcacgagcagttgagcagcagcggctctgagtcagacacagaggctgggaaggacagggcttcccggagcatcagggacgaccagaaggaagccgagaaaccctgtcagggaagcaatgcggctgctgctgttgctgctgctgctggacatcggtccatttggctggaagatattcacgatctgaccgacgtcttcaggactgataagaagccagatcctgccaactgggagtataaatctctgtatcgtggggatatagcaaggtacaagaggaagggagactcctgcctgggtatcaatcctaagaaacagtgtatatcttgggaaggggcttctgcagcaaagaagcactcacacaggcacctggagcgctattttaccaagaagaatgtggggttaatgagaacagagggcattgctgtgtgcagtaaccccgagcctgcctcctccgagcccgtcacattcatcccagtgaaggactctgctgaggcagctactcctgttacatcatggctgaatcctctggggatttatgatcagtctaccacacagtggttacaaggacagggtccagcagagcaagagtcaaagcagccggactcgcaacaggacagggagaatgctgctctcaaggccagagtggaagagtttaacagaagggttcgggagaatccttgggacacgcaactatggatggcgtttgtggctttccaggacgaggtcatgaggagtcctggcatctatgcccttggggaaggagaacaggagaagcacaggaagtccctgaagctcctcctggagaagaagctggctgtgctggagcgggccatcgagagcaacccaggcagcgtggagctgaagcttgccaagctgcagctgtgctcagagttctgggagcccagtgcgctggccaaggagtggcagaagctcctcttcctgcaccccaacaacacaagcctgtggcagcgctatctctccttttgccagagccagtttggtaccttttctgtgtccaaactccacagtctgtatggcaagtgcttgagtaccttgtctgctgttaaagatggcagcatgctatcccaccctgtgttgccgggcaccgaggaggccatgtttgggctctttcttcagcagtgccactttctacggcaggctggccactcagagaaggtcatctctttgttccaggccatggttgacttcaccttcttcaagcctgacagtgtgaaagagctgcctactaaagtacaggtggaattctttgagcccttctgggacagcggagaaccacgcgttggggagaagggagcccgaggctggcgggcgtggatgcaccaacaggagcgaggtggctgggtgctcatcaccccagatgaggatgacgaggagcccgaagaggaggaccaggagataaaagacaagaccctgccccggtggcagatctggcttgctgttgagcgttctcgagaccagaggcactggcgtccctggcgccctgataagaccaagaagcaaacggaggaagactgtgaggaccctgagagacaggtgctgtttgatgacattgggcaatctttgatcagactttccagcccagaccttcagttccagctcatccaggcctttctgcagttcctgggcgtgccttccggcttcctgcccccagcctcctgcctttacctggccatggacgagagcagcatctttgagagtgaactttatgatgaaaagcccctgacttacttcaacccttccttttcgggcattagctgtgtcggctccatggaacagttgggtcgccctcgctggaccaaaggtcacaaccgagagggcgaggagtttgtccgcaatgtcttccacctggtgctgcctttgctcgcaggcaagcagaagtcccagctcagcctctcctggttacggtacgagattgcaaaggtcatttggtgtctacacactaaaaagaagcgattgaagtctcagggaaagagctgcaaaaaactagccaagaatctcctcaaggagccagaaaaccgcaacaacttctgcctctggaagcagtatgcacacctggagtggttgctcggtaacacagaggatgccagaaaagtgttcgacacagcactcagcatggcaggcagcagcgagctgaaggaccgtgaactctgcgagctcagtctgctctatgccgagctggagatggaactgtcgccggactcgagaggagccaccacaggccgagcggtccacatattaacacggctgacggagagcagtccctacgggccctacacggggcaggtctcgtccacccaggtgctgaaagctcggaaggcttacgagctcgcgctgcaggactgcctgggccagagctgtgcctccagcccagctcctgcagaggccttggactgcctgggtagcttggtccgatgctttatgctcttccagtatttgactgtgggcattgatgctgctgtgcagatatacggaagggtgtttgccaagctgaagggctctgctcgcttagaagacccagggccagaggacagcaccagctcccagagtttgaccaatgtgctcgaggctgtcagcatgatgcacacaagcctgctgcgattccacatgaacgtttgtgtttaccctctggctccactccgagagaccctctccgatgctttaaagctgtatccgggcaaccaggttctttggagggcttatgtacagattcagaataagtcccacagtgctaacaagaccagaaggttctttgacacagttactaggtctgccaaacatttggagccttggctatttgcaatcgaagctgagaagctgaggaaaaagctagtggaatctgttcagagggtcagcatagcgaagaaacacattcttggccagtgtccttgcttatgccacacctatactggctgccggcatgctcacccctgagggacagaacacctctgaaaagcggatccagacgccgctgcgcttcgccattgctgaagtatgtcttcccgctgggatgtcgggcacagaacctgtcttagaatgacctgagttctttccttgcagggtaggaggcagagaggtccatgcaacaatccccgagactggccttacgcatcgcatcagagctttgtttgaaaatgcgattcggagcgacaagggcaaccagtgtcccctactgtggaggatgtatttgaattttttggtttccttaggaaacaaagaaagaagcaaaggcgtgttctacaaggccctccagagctgtccttgggcaaaggtgctatacatggacgccatggagtatttcccagacgagctgcaggagatcctggacgtgatgaccgagaaggagctccgtgtgcgcctgccccttgaggagctggagctgctgctggaggattagtgtgcagccaggcctgggccagcctgcagagcccaaagccgcagctgtgcaggctccactgtcctgctggggttggacgtattgacttacatattatatatgtgatctctatgtacaagtggagtcgtgccagtgataaaccttttgtggttgaca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]