GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 14:51:24, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       NR_132637                594 bp    RNA     linear   ROD 08-OCT-2016
DEFINITION  Rattus norvegicus homeobox B5 and homeobox B6, opposite strand
            (Hoxb5os), long non-coding RNA.
ACCESSION   NR_132637
VERSION     NR_132637.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AABR07030395.1.
            
            Sequence Note: This RefSeq record was created from genomic sequence
            data to make the sequence consistent with the reference genome
            assembly. The genomic coordinates used for the transcript record
            were based on transcript alignments and orthologous data.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMN02642780
                              [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-169               AABR07030395.1     49716-49884         c
            170-348             AABR07030395.1     36180-36358         c
            349-594             AABR07030395.1     33841-34086         c
FEATURES             Location/Qualifiers
     source          1..594
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="mixed"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /map="10q26"
     gene            1..594
                     /gene="Hoxb5os"
                     /note="homeobox B5 and homeobox B6, opposite strand"
                     /db_xref="GeneID:106455138"
                     /db_xref="RGD:10395317"
     ncRNA           1..594
                     /ncRNA_class="lncRNA"
                     /gene="Hoxb5os"
                     /product="homeobox B5 and homeobox B6, opposite strand"
                     /db_xref="GeneID:106455138"
                     /db_xref="RGD:10395317"
ORIGIN      
atgtcatagcgacttttggggtagtttgctttcggcaaagggggacaaagtcatggggtgagagggaaggagggcccaatgcagcctccaagaccctcaccatctcttcaccggctccccccccccaggtcctgtaagaagttgggcccagctggaagggattgaccggaagcctcctcgccctcggctggcctctgcggagattccaggccccacagagaccaggacgtccctcagcgccaccgcccctcgtgccaatgcagccgggaaatcgccgttacccacactgggcaagagaaccgcacgggggcaatcggggaggccaggacaagggaaaagtggagggagaaggttccaggttggccgtattcaagagcaggctgagcagcgcagaggaagccctggcggcgccggcgctgccaagcttactgcgtccacccaccccagcccggtaaactctccgtcgctcatggggactggttttcctcccattttaaaattttatatggatagcccatgtcaatttagaatgaaatagattttaatacactaagtaaaaacaaattgaaataaaataaaggaatcactccaacg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]