GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 14:37:00, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       NR_131758                583 bp    RNA     linear   ROD 26-MAY-2018
DEFINITION  Mus musculus homeobox B5 and homeobox B6, opposite strand
            (Hoxb5os), long non-coding RNA.
ACCESSION   NR_131758
VERSION     NR_131758.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 583)
  AUTHORS   Harrow JL, Steward CA, Frankish A, Gilbert JG, Gonzalez JM,
            Loveland JE, Mudge J, Sheppard D, Thomas M, Trevanion S and Wilming
            LG.
  TITLE     The Vertebrate Genome Annotation browser 10 years on
  JOURNAL   Nucleic Acids Res. 42 (Database issue), D771-D779 (2014)
   PUBMED   24316575
REFERENCE   2  (bases 1 to 583)
  AUTHORS   Dinger ME, Amaral PP, Mercer TR, Pang KC, Bruce SJ, Gardiner BB,
            Askarian-Amiri ME, Ru K, Solda G, Simons C, Sunkin SM, Crowe ML,
            Grimmond SM, Perkins AC and Mattick JS.
  TITLE     Long noncoding RNAs in mouse embryonic stem cell pluripotency and
            differentiation
  JOURNAL   Genome Res. 18 (9), 1433-1445 (2008)
   PUBMED   18562676
REFERENCE   3  (bases 1 to 583)
  AUTHORS   Takasato M, Osafune K, Matsumoto Y, Kataoka Y, Yoshida N, Meguro H,
            Aburatani H, Asashima M and Nishinakamura R.
  TITLE     Identification of kidney mesenchymal genes by a combination of
            microarray analysis and Sall1-GFP knockin mice
  JOURNAL   Mech. Dev. 121 (6), 547-557 (2004)
   PUBMED   15172686
COMMENT     PREDICTED REFSEQ: This record has not been reviewed and the
            function is unknown. The reference sequence was derived from
            AK002860.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK002860.1, BY703358.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849384, SAMN01164142
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-583               AK002860.1         2-584
FEATURES             Location/Qualifiers
     source          1..583
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="11"
                     /map="11"
     gene            1..583
                     /gene="Hoxb5os"
                     /gene_synonym="0610040B09Rik; AV302770; Hoxb5/6as"
                     /note="homeobox B5 and homeobox B6, opposite strand"
                     /db_xref="GeneID:75395"
                     /db_xref="MGI:MGI:1922645"
     ncRNA           1..583
                     /ncRNA_class="lncRNA"
                     /gene="Hoxb5os"
                     /gene_synonym="0610040B09Rik; AV302770; Hoxb5/6as"
                     /product="homeobox B5 and homeobox B6, opposite strand"
                     /db_xref="GeneID:75395"
                     /db_xref="MGI:MGI:1922645"
     exon            1..174
                     /gene="Hoxb5os"
                     /gene_synonym="0610040B09Rik; AV302770; Hoxb5/6as"
                     /inference="alignment:Splign:2.0.8"
     exon            175..354
                     /gene="Hoxb5os"
                     /gene_synonym="0610040B09Rik; AV302770; Hoxb5/6as"
                     /inference="alignment:Splign:2.0.8"
     exon            355..583
                     /gene="Hoxb5os"
                     /gene_synonym="0610040B09Rik; AV302770; Hoxb5/6as"
                     /inference="alignment:Splign:2.0.8"
ORIGIN      
atgtcatagcgacttttggggtagtttgctttcggcaaagggggacaaagtcatggggtgagagggaaggaggacccaaaacagcctccaagaccctcaccatctcttcaccggctccccctccccccccacaggtcctgtaagaagttgggcccagctggaagggattgaccgacgcctcttcgccctaggctggcctctgcggagattccaggccccacagagaccaggacttccctcagcgccaccgcccctcgtgccaatgcagccgggaaatcgccattacccacactgggcaagagaaaccgcacgggggcaatcggagaggccaggaaaagggagagatggagggagaaggttccaggttggccgtactcaggagcaggccgaacggcccagaggaagccctggcgtccggtgctgccaggctcactgcggacgcaccccagcccggtaaactcactgtcgctcgccgggactggtttcccttcaatttaaaaatttcatgtggatcgcccatgccaatttagaatgaaatagatttaaatacataaagtaaaaataaattgaaataaaagcaagg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]